Informations

Comment prédire l'ampleur de l'effet sur la dérive antigénique d'une substitution dans la séquence d'acides aminés d'une protéine de surface de la grippe ?

Comment prédire l'ampleur de l'effet sur la dérive antigénique d'une substitution dans la séquence d'acides aminés d'une protéine de surface de la grippe ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Je sais que certaines substitutions d'acides aminés sont plus efficaces pour provoquer une dérive antigénique que d'autres substitutions en fonction de leur emplacement dans la structure 3D de la protéine HA (proximité du site de liaison du récepteur).

J'aimerais pouvoir déterminer à l'aide d'un programme si un virus sera dominant en fonction de plusieurs facteurs, y compris la différence génétique par rapport au virus précédemment dominant. Comment peut-on savoir à quel point une substitution d'AA aura un effet plus important sur l'antigénicité d'un virus par rapport à une autre ?

Toute aide est très appréciée.


Votre compréhension de la dérive antigénique de la grippe est, malheureusement, hypersimplifiée et pour la plupart erronée. En particulier, votre notion selon laquelle certaines mutations sont plus importantes pour la dérive antigénique en raison de leurs effets sur la structure est au mieux simpliste.

Plutôt que de passer de nombreux paragraphes à passer en revue les schémas complexes impliqués, je vous suggère de commencer par lire attentivement les articles de personnes qui ont corrélé la dérive antigénique avec le changement de séquence, tels que

C'est un domaine que beaucoup de gens extrêmement intelligents étudient de très près depuis de nombreuses années; toutes les approches simples ont déjà été essayées.


Prédire l'antigénicité des virus de la grippe A à l'aide d'idées biophysiques

Les variations antigéniques des virus de la grippe A sont induites par une mutation génomique de leur protéine transmembranaire HA1, provoquant l'échappement viral de la neutralisation par les anticorps générés lors d'infections ou de vaccinations antérieures. La prédiction des relations antigéniques entre les virus de la grippe est utile pour concevoir (ou mettre à jour les vaccins antigrippaux existants), fournit des informations importantes sur les mécanismes évolutifs qui sous-tendent les variations antigéniques virales et aide à comprendre l'épidémiologie virale. Dans cette étude, nous présentons un modèle simple et physiquement interprétable qui peut prédire les relations antigéniques entre les virus de la grippe A, sur la base d'idées biophysiques, en utilisant à la fois des séquences d'acides aminés génomiques et des données antigéniques expérimentales. Nous démontrons l'applicabilité du modèle à l'aide d'un ensemble de données de référence de quatre sous-types de virus de la grippe A (H1N1, H3N2, H5N1 et H9N2) et rendons compte de ses profils de performance. De plus, l'analyse des paramètres du modèle confirme plusieurs observations qui sont cohérentes avec les résultats d'autres études antérieures, pour lesquelles nous fournissons des explications plausibles.


Introduction

Causant environ 500 000 décès dans le monde par an, les épidémies de grippe chez l'homme mettent gravement en danger la santé de la population et l'économie mondiale 1 . La vaccination est la principale option pour réduire les épidémies de grippe. L'efficacité d'un vaccin contre la grippe saisonnière dépend en grande partie de la sélection des souches vaccinales, c'est-à-dire des souches que ce vaccin est conçu pour prévenir. Une bonne recette de vaccin devrait cibler les souches circulantes potentielles capables d'échapper à l'immunité de la population lors de la nouvelle saison grippale 2 . Cependant, les virus de la grippe sont des exemples classiques d'agents pathogènes antigéniquement variables et ont une capacité apparemment infinie d'échapper à la réponse immunitaire 3 , ce qui rend la conception de vaccins extrêmement difficile. Selon les rapports du Centre de contrôle et de prévention des maladies (CDC), les vaccins contre la grippe échouent la moitié du temps 4 . À ce titre, l'identification en temps opportun des variants antigéniques émergents est essentielle à la conception d'un vaccin antigrippal, à la surveillance de la grippe et à la santé humaine 5 .

L'un des tests les plus populaires pour évaluer l'efficacité d'un vaccin contre un virus de la grippe est le test d'inhibition de l'hémagglutination (HI), un test de liaison mesurant la capacité des antisérums (vaccin) à bloquer l'hémagglutinine (HA) de l'antigène (virus) provenant de l' agglutination des globules rouges 6 . Cependant, le test HI est laborieux et coûteux, ce qui nécessite des méthodes de calcul efficaces pour estimer la similitude antigénique entre les antigènes et les antisérums 2 . Avec les progrès des techniques de séquençage, les séquences grippales sont devenues de plus en plus disponibles 7 , ce qui en fait de bons candidats pour prédire l'antigénicité de nouveaux virus et identifier des variants antigéniques.

Les méthodes de prédiction antigéniques populaires comprennent les méthodes basées sur l'imputation 5, 8 et les méthodes basées sur la séquence. Les méthodes basées sur la séquence associent généralement des mutations dans les protéines HA avec des différences antigéniques (parmi les virus) obtenues à partir des tests sérologiques 5, 8, 9 . Les différences antigéniques sont soit quantifiées par des distances antigéniques 5 soit simplement représentées par une valeur binaire pour indiquer si deux virus sont des variants antigéniques 9, 10 . Par exemple, Liao et al. testé quatre algorithmes, y compris le filtrage itératif, la régression multiple, la régression logistique et la machine à vecteurs de support pour prédire les variantes antigéniques à partir de mutations dans HA1, une sous-unité de HA formant le domaine globulaire 11 . Ils ont également exploré six modèles de substitution d'acides aminés basés sur le groupement physicochimique de 20 acides aminés 10 . soleil et al. proposé Antigen-Bridges, un modèle de régression de crête bootstrap, pour prédire les distances antigéniques à l'aide de substitutions d'acides aminés quantifiées par l'alignement multiséquence induit par motif (PIMA) dans les séquences de protéines HA1 2 . Comme les virus de la grippe H3N2 de 1968 à 2003 sont regroupés en 11 groupes antigéniques, c'est-à-dire HK68, EN72, VI75, TX77, BK79, SI87, BE89, BE92, WU95, SY97 et FU02 par ordre chronologique 5 , ils ont également prédit les mutations HA à l'origine de événements de dérive antigénique entre des groupes adjacents et validation expérimentale de deux ensembles de mutations prédits (c'est-à-dire de BE92 à WU95 et de WU95 à SY97). Remarquant que la co-évolution dans HA1 pourrait contribuer à l'évolution antigénique, Yang et al. développé un modèle Lasso incorporant à la fois des caractéristiques de mutation unique et de co-mutation dans les séquences de protéines HA1 12 . Plus récemment, Qiu et al. développé un modèle de prédiction antigénique basé sur la structure des protéines 13 , et Neher et al. a développé un modèle d'optimisation pour interpréter les données antigéniques connues et évalué sa capacité à prédire la composition des futures populations de virus de la grippe 14 . Il existe également de nombreuses autres méthodes dans ce sujet brûlant, par exemple, Huang et al. 15 et Ren et al. 16 pour n'en citer que quelques-uns.

Malgré le fait que ces méthodes soient très utiles pour sélectionner des variants antigéniques et optimiser les souches vaccinales, il reste encore quelques points à améliorer. Tout d'abord, il est connu que les matrices de notation pour quantifier les substitutions d'acides aminés sont essentielles à la précision des algorithmes de prédiction 10, 13 . Cependant, seules quelques matrices reflétant les attributs partiels des protéines ont été testées, par exemple, la matrice de substitution binaire 17, les modèles physicochimiques 10, PAM250, BLOSUM62, PIMA 12 et le modèle de structure 13. Une étude systématique de la relation entre les attributs des acides aminés et l'antigénicité de la grippe fait largement défaut. AAindex, une base de données d'indices numériques représentant diverses propriétés physico-chimiques et biochimiques des acides aminés et des paires d'acides aminés, offre l'opportunité de combler cette lacune 18 . Les pouvoirs prédictifs des 94 propriétés physicochimiques et biochimiques des acides aminés dans l'AAindex pourraient être utiles pour élucider leur contribution à l'évolution antigénique de la grippe. Deuxièmement, il n'est pas clair si la combinaison de quelques attributs importants d'acides aminés peut mieux prédire l'antigénicité de la grippe. Troisièmement, la plupart des modèles précédents prédisent les variantes antigéniques ou adoptent des modèles linéaires. Il pourrait y avoir certains avantages à prédire les distances antigéniques continues en utilisant des modèles non linéaires comme la forêt aléatoire 19, car les distances antigéniques ont une résolution plus élevée que les valeurs binaires et la relation entre les sites antigéniques pourrait être non linéaire.

Dans cette étude, nous proposons et testons Jpommade Random Fforêt Regression (JRFR), un nouvel algorithme qui combine plusieurs matrices de substitution dans l'algorithme de forêt aléatoire pour prédire les distances antigéniques à partir des séquences de protéines HA1. Nous comparons également systématiquement 95 matrices de substitution d'acides aminés pour prédire l'antigénicité des virus de la grippe H3N2. Ces matrices de substitution reflètent une liste complète d'attributs d'acides aminés, y compris des informations structurelles, physicochimiques et biochimiques. Enfin, nous explorons la relation entre l'évolution génétique et antigénique des virus de la grippe H3N2 sur la base des résultats de prédiction de JRFR.


Les mutations de pointe reçoivent une attention précoce

Le taux d'évolution du SRAS-CoV-2 de décembre 2019 à octobre 2020 était cohérent avec le virus acquérant environ deux mutations par mois dans la population mondiale 15,16. Bien que notre compréhension des conséquences fonctionnelles des mutations de pointe se développe rapidement, une grande partie de ces connaissances implique l'étude réactive des changements d'acides aminés identifiés comme augmentant rapidement en fréquence ou associés à des caractéristiques épidémiologiques inhabituelles. Suite à l'émergence de D614G, une substitution d'acides aminés au sein du motif de liaison au récepteur (RBM), N439K, a été notée comme augmentant en fréquence en Écosse en mars 2020. Alors que cette première lignée avec N439K (désignée B.1.141 avec le système de nomenclature Pango 17 ) s'est rapidement éteinte, une autre lignée qui a acquis indépendamment N439K (B.1.258) a émergé et a largement circulé dans de nombreux pays européens 18 . N439K est remarquable car il améliore l'affinité de liaison pour le récepteur ACE2 et réduit l'activité neutralisante de certains anticorps monoclonaux (mAb) et anticorps polyclonaux présents dans les sérums de personnes guéries d'une infection 18 . Un autre changement d'acide aminé RBM, Y453F - associé à une affinité accrue de liaison à l'ACE2 19 - a reçu une attention considérable suite à son identification dans des séquences associées à des infections chez l'homme et le vison, notamment une lignée identifiée au Danemark et initialement nommée « cluster 5 » (maintenant B. 1.1.298) 20 . Au 5 novembre 2020, 214 humains infectés par le SRAS-CoV-2 lié au vison étaient tous porteurs de la mutation Y453F 21 . La lignée B.1.1.298 a également Δ69-70, une délétion du domaine amino-terminal (NTD) qui a émergé plusieurs fois dans la population mondiale du SRAS-CoV-2, y compris dans la deuxième lignée N439K, B.1.258. Le Δ69-70 devrait modifier la conformation d'une boucle d'ATN exposée et il a été rapporté qu'il est associé à une infectiosité accrue 22 .

Les analyses génomiques indiquent un changement dans l'environnement de l'hôte et des signatures de pressions sélectives accrues agissant sur les gènes immunologiquement importants du SRAS-CoV-2 échantillonnés vers novembre 2020 (réf. 23). Cela a coïncidé avec l'émergence de variantes avec un nombre plus élevé de mutations par rapport aux variantes circulantes précédentes. Ces lignées, en raison de leur association avec une transmissibilité accrue, ont été nommées « variantes préoccupantes ». Ils sont définis par de multiples mutations convergentes qui sont supposées être apparues soit dans le contexte d'infections chroniques, soit chez des individus précédemment infectés 24,25,26,27,28,29. En plus de comprendre la transmissibilité et la pathogénicité de ces variants émergents, il est crucial de caractériser leur antigénicité et le niveau de protection croisée fourni par l'infection par des virus antérieurs qui sont génétiquement et antigéniquement similaires au virus qui est apparu pour la première fois en décembre 2019 et qui est utilisé dans toutes les préparations vaccinales actuelles. Les informations sur la façon dont les mutations de pointe affectent les profils antigéniques peuvent être dérivées d'études structurelles, de mutations identifiées dans des virus exposés à des mAb ou de plasma contenant des anticorps polyclonaux, des études ciblées de variantes utilisant la mutagenèse dirigée et des expériences de balayage mutationnel profond (DMS) qui étudient systématiquement la possibilité de mutations survenant.


Résultats

Une charge mutationnelle délétère modifie le rythme et la nature de l'évolution antigénique de la grippe

Pour comprendre comment les mutations délétères circulantes affecteront les modèles d'évolution antigénique de la grippe, nous étendons d'abord les modèles génétiques de population existants (Haigh, 1978 Peck, 1994) aux maladies infectieuses aiguës subissant une évasion immunitaire. Comme cela est courant dans de nombreux modèles de génétique des populations, nous supposons une population infinie et considérons cette population sujette à de fréquentes mutations délétères sublétales qui agissent indépendamment les unes des autres en réduisant la valeur adaptative. Dans un contexte épidémiologique explicite sensible-infecté-récupéré (SIR) qui n'intègre pas encore l'évasion immunitaire, ces hypothèses conduisent à un équilibre mutation-sélection délétère dans la population virale (« Matériels et méthodes », Figure 1A). Ce bilan est donné par une distribution de Poisson de moyenne ??/s, où ?? est le taux de mutation délétère par génome et s est le coût d'adaptation de la transmission des mutations délétères sublétales. La population virale à l'équilibre épidémiologique aura un taux de reproduction net global (c'est-à-dire une valeur adaptative absolue moyenne) de R = 1, avec plus de virus transmissibles qui portent moins de mutations délétères ayant des taux de reproduction supérieurs à un et moins de virus transmissibles qui portent des mutations plus délétères ayant des taux de reproduction inférieurs à un (Figure 1A, encadré). Cette variation au sein de la population des taux de transmission virale se reflète également dans la distribution des taux de reproduction de base des individus infectés (R0 valeurs) (Figure 1A encadré).

L'effet d'une charge mutationnelle délétère sur le devenir d'un mutant antigénique.

(UNE) Une souche antigénique résidente à son équilibre mutation-sélection délétère. L'histogramme montre pk, la proportion d'individus infectés porteurs d'un virus k mutations délétères à son équilibre endémique. La classe virale portant le moins de mutations délétères est définie comme la classe de mutation k = 0. Encart : variation du taux de reproduction de base des individus infectés (histogramme gris) et variation du taux de reproduction net R d'individus infectés (histogramme brun) résultant de la variation du nombre de mutations délétères portées par les virus circulants. Paramètres du modèle : ?? = 0.10, s = 0.008, ?? = 1/30 ans −1 , ?? = 1/4 jours −1 , R0,k = 0 = 2.25. (B) Simulations montrant les trois destins dynamiques qu'un mutant antigénique peut subir : perte rapide (bleu, avec encart élargi), circulation transitoire (vert) et établissement réussi (rouge). Le mutant antigénique bleu (avec ?? = 0,008) survient dans un contexte génétique avec k = 16 mutations délétères. Le mutant antigénique vert (avec ?? = 0,04) survient dans un fond de k = 10 mutations délétères. Le mutant antigénique rouge (avec ?? = 0,06) survient dans un fond de k = 5 mutations délétères. Tous les autres paramètres sont comme dans (UNE). (C) La proportion de mutants antigéniques qui entraînent chacun des trois destins dynamiques indiqués dans (B) en fonction de leur taille antigénique ??. Tous les paramètres comme dans (UNE). () La taille antigénique moyenne de l'établissement réussi de mutants antigéniques sous différents taux de mutation délétères ?? (axe des x) et pour trois coûts d'aptitude à la transmission (voir (E) pour la légende). La taille des mutations antigéniques apparaissant ?? sont supposés être distribués gamma avec une moyenne de 0,012 et un paramètre de forme de 2. Tous les autres paramètres sont comme dans (UNE). (E) Le taux relatif d'évolution antigénique sous différents taux de mutations délétères ?? (axe des x) et pour les trois coûts d'aptitude à la transmission indiqués dans (). Les autres paramètres du modèle sont comme dans (). Le taux relatif d'évolution antigénique est donné par la fraction de mutants antigéniques naissants qui s'établissent sous la charge de mutation délétère par rapport à la fraction de mutants antigéniques naissants qui s'établiraient dans un scénario sans charge. Voir « Matériaux et méthodes » pour le choix des paramètres du modèle.

À la suite de Peck (1994), nous examinons d'abord le sort d'un seul mutant avantageux apparaissant dans une telle population. Ce mutant avantageux sera nécessairement issu d'un fond génétique avec un certain nombre de mutations délétères et, dans notre cas, portera une mutation d'échappement immunitaire bénéfique à sa propagation. Le fond génétique dans lequel la mutation antigénique survient et la taille du changement antigénique déterminent conjointement le taux de reproduction initial du mutant Rm(t = 0) dans la population virale (« Matériels et méthodes »). Si ce taux de reproduction initial est inférieur à un, le mutant antigénique est susceptible d'être rapidement perdu de la population virale. Si le taux de reproduction initial du mutant est plutôt supérieur à un, le mutant envahira la population virale s'il n'est pas initialement perdu de manière stochastique. En cas d'invasion, le taux de reproduction moyen de la lignée de mutants antigéniques diminuera nécessairement car elle accumulera son propre ensemble de mutations délétères. (Le taux de reproduction moyen de la lignée mutante diminuera également nécessairement car la taille de son pool d'hôtes sensibles diminuera avec le temps, un facteur que nous ignorons pour l'instant mais auquel nous reviendrons dans les modèles ultérieurs.) Pour cette lignée mutante antigénique envahissante, nous pouvons calculer un taux de reproduction Rm(t = ∞), qui est le taux de reproduction moyen de cette lignée une fois qu'elle a atteint son propre équilibre mutation-sélection (« Matériels et méthodes »). Si ce taux de reproduction final tombe en dessous de un, un mutant antigénique envahissant ne circulera donc que de manière transitoire avant de décliner de manière déterministe en raison d'une accumulation de mutations délétères. Si ce taux de reproduction final dépasse un, cependant, la lignée de mutants antigéniques envahissants, selon les hypothèses de ce modèle, s'établira avec succès. Les mutants antigéniques subissent donc l'un des trois destins possibles (figure 1B): perte rapide, circulation transitoire ou établissement réussi.

Lequel de ces trois destins attend un mutant antigénique dépend en partie du nombre de mutations délétères portées par la souche dans laquelle la mutation antigénique survient : plus le nombre de mutations délétères de fond est faible, plus les chances du mutant antigénique de s'établir au moins transitoirement sont élevées. , cohérent avec les effets d'interférence de fond sur la condition physique trouvés dans Illingworth et Mustonen (2012). Le sort qui se produit dépend également de la mesure dans laquelle le mutant antigénique échappe à l'immunité (figure 1C). La grande majorité des mutants antigéniques de petite taille sont rapidement perdus, les autres ne circulent que de manière transitoire avant que l'accumulation de mutations délétères n'entraîne leur perte définitive. Les mutants antigéniques qui échappent de manière significative à l'immunité sont moins sujets à une perte rapide et également moins susceptibles de circuler que de manière transitoire.Étant donné une distribution de taille spécifiée pour les mutations antigéniques, la taille moyenne des mutations antigéniques qui s'établiront avec succès peut être calculée. La figure 1D montre que cette taille antigénique moyenne augmente avec l'augmentation du taux de mutation délétère ??. L'ampleur du coût de remise en forme de la transmission s affecte également la taille moyenne des mutants antigéniques qui s'établiront avec succès. Pour tout taux de mutation délétère donné ??, comme s diminue la taille moyenne des mutants antigéniques qui fixent augmente (figure 1D). Ces résultats peuvent être interprétés dans le contexte des découvertes de la littérature sur la génétique des populations : ?? et diminue dans s augmenter de la même manière la variance de la valeur adaptative de la population virale (comme quantifiée par la variance du taux de reproduction net R, encadré de la figure 1A, « Matériaux et méthodes »). L'augmentation de la variance de la valeur adaptative des populations asexuées rend la fixation d'un mutant bénéfique de plus en plus dépendante du patrimoine génétique. al., 2011 Good et al., 2012).

En plus de leur effet sur la taille des mutants antigéniques établis avec succès, les mutations délétères circulantes agiront pour ralentir le rythme de l'évolution antigénique (figure 1E), c'est-à-dire qu'elles réduiront le nombre de mutants antigéniques qui se fixent dans une quantité donnée de temps. Cet effet particulier a déjà été remarqué dans le contexte d'un modèle de génétique des populations pour la protéine HA de la grippe (Strelkowa et Lässig, 2012). Encore une fois, l'augmentation de la variance de fitness de la population virale est le coupable : augmentation du taux de mutation délétère ?? et diminution du coût de remise en forme des mutations délétères s agissent de la même manière pour augmenter la variance de la valeur adaptative avec une variance accrue de la valeur adaptative dans la population, le contexte génétique dans lequel un mutant antigénique doit apparaître pour avoir une chance de fixation sera de plus en plus restrictif. Cela conduit à un tempo réduit de changement antigénique, compatible avec une réduction du taux d'adaptation qui est connue de la littérature sur la génétique des populations (Peck, 1994 Barton, 1995).

Les résultats de notre modèle peuvent maintenant être situés dans le contexte de la dynamique évolutive caractérisée de la grippe A/H3N2 chez l'homme. En particulier, des analyses antigéniques détaillées ont démontré que ce virus subit une évolution antigénique ponctuée, avec des changements principalement d'acides aminés à effet antigénique important étant responsables de l'apparition de transitions de clusters antigéniques (Smith et al., 2004 Koel et al., 2013). Cette dynamique est cohérente avec nos résultats selon lesquels l'évolution antigénique - telle que tracée par des lignées qui se fixent finalement - devrait se produire via des mutations de grande taille caractéristique. Ces mêmes analyses, ainsi que d'autres (Plotkin et al., 2002), ont en outre indiqué que les transitions de grappes antigéniques ne se produisent que tous les 2 à 6 ans, un rythme incroyablement lent étant donné le taux de mutation élevé du virus et le besoin d'un seul acide aminé. acide pour altérer substantiellement l'antigénicité. Encore une fois, cette dynamique est cohérente avec nos résultats selon lesquels le rythme de l'évolution antigénique devrait être sévèrement réduit par des mutations délétères circulantes. Ainsi, notre modèle postule que la nature ponctuée et étonnamment lente de l'évolution antigénique de la grippe A/H3N2 sont des caractéristiques apparentées de cette population en grande partie asexuée, adaptative, soumise à une charge de mutation délétère : l'évolution adaptative nécessite non seulement l'apparition de grands mutants antigéniques, mais aussi que ils se produisent dans de bons antécédents génétiques.

Le modèle ci-dessus contient un certain nombre d'hypothèses simplificatrices. Parmi ceux-ci figurent le fait que le pool d'hôtes sensibles est affecté de manière négligeable au cours de la période d'établissement du mutant antigénique et que l'établissement réussi d'un mutant antigénique conduira à la fixation de la lignée mutante dans la population virale. Bien que ces hypothèses puissent être raisonnables dans certains scénarios, elles peuvent ne pas toujours être dans un contexte épidémiologique. Par exemple, un mutant antigénique pourrait envahir suffisamment lentement pour éroder son avantage dépendant de la fréquence avant l'exclusion de la lignée antigénique existante. En raison de l'immunité croisée seulement partielle entre ces lignées, cela conduirait à une coexistence à long terme des variantes. Un autre scénario est celui d'un mutant antigénique doté d'un avantage sélectif particulièrement important : ce mutant pourrait brûler sa population d'hôtes sensibles si rapidement que son taux de reproduction net chute nettement en dessous de un, conduisant à la possibilité de sa propre extinction avec celle du précédent. variante circulante (Ballesteros et al., 2009). Ce scénario souligne l'importance d'envisager la possibilité d'une taille de population virale variable Les modèles génétiques de population qui supposent une taille de population constante peuvent ne pas être appropriés dans certaines conditions épidémiologiques.

Pour assouplir à la fois l'hypothèse d'un avantage sélectif invariant dans le temps et l'hypothèse selon laquelle l'établissement réussi d'un mutant conduit à la fixation de la lignée mutante (y compris le remplacement de la lignée résidente), nous considérons maintenant un modèle épidémiologique plus complexe qui intègre explicitement la dynamique des hôtes sensibles ("Matériels et méthodes"). La figure 2 montre la dynamique de la souche résidente et du mutant antigénique dans quatre scénarios distincts : un scénario dans lequel un petit mutant antigénique apparaît dans un fond génétique à faible charge (« bon ») (figure 2A) un scénario dans lequel un petit le mutant apparaît dans un fond génétique de charge moyenne (figure 2B) un scénario dans lequel un grand mutant antigénique apparaît dans un bon fond génétique (figure 2C) et un scénario dans lequel un grand mutant antigénique apparaît dans un fond génétique moyen (figure 2D) . Ces simulations indiquent que les trois destins prédits dans le modèle plus simple se déroulent toujours dans le contexte explicite de la dynamique épidémiologique lorsqu'ils sont paramétrés pour la grippe A/H3N2 chez l'homme. On s'attend à ce qu'une perte rapide se produise lorsqu'un petit mutant antigénique apparaît dans un fond génétique moyen (figure 2B). Comme cette combinaison se produit fréquemment, la perte rapide est le sort le plus fréquent rencontré par les mutants antigéniques. La circulation transitoire se produit lorsqu'un petit mutant antigénique apparaît dans un bon fond génétique (figure 2A), à condition qu'il ait survécu à une dérive génétique. La circulation transitoire se produit également lorsqu'un grand mutant antigénique apparaît dans un contexte génétique moyen (figure 2D), à nouveau à condition qu'il ait survécu à la dérive génétique. Un établissement réussi ne peut se produire que lorsqu'une grande mutation antigénique apparaît dans un bon fond génétique (figure 2C), une combinaison « jackpot ». Dans ce cas, la souche résidente est exclue de manière compétitive en raison de l'immunité croisée de la souche. Curieusement, la présence de mutations délétères peut également affecter la dynamique d'invasion des mutants antigéniques ayant cette combinaison « jackpot » : parce que la progéniture des mutants antigéniques accumule des mutations délétères et que ces mutations délétères réduisent la transmissibilité virale, la dynamique d'invasion des mutants antigéniques particulièrement grands est considérablement moins explosif que ce à quoi on pourrait s'attendre en l'absence d'accumulation de mutations délétères (Figure 3). Par conséquent, les grands mutants antigéniques ne s'épuisent pas facilement lors d'une tentative d'établissement, comme on pourrait s'y attendre en théorie (Ballesteros et al., 2009).

Dynamique épidémiologique suite à l'émergence d'un mutant antigénique.

Première rangée : mutants antigéniques issus de fonds génétiques à faible charge (k = 3 mutations délétères). Deuxième rangée : mutants antigéniques provenant de fonds génétiques à charge moyenne (k = 13 mutations délétères). Colonne de gauche : mutants antigéniques de petite taille (?? = 0,004). Colonne de droite : mutants antigéniques de grande taille (?? = 0.045). (UNE) De petits mutants antigéniques issus de bons fonds génétiques circulent de manière transitoire. (B) Les petits mutants antigéniques apparaissant dans les fonds génétiques moyens sont rapidement perdus. (C) Les grands mutants antigéniques issus de bons antécédents génétiques peuvent établir et exclure avec succès la souche antigénique résidente, ce qui entraîne une transition de cluster antigénique. () De grands mutants antigéniques issus de milieux génétiques moyens circulent de manière transitoire. Toutes les simulations supposent une taille de population hôte de N = 4 milliards et partir d'une seule souche antigénique à l'équilibre évolutif et épidémiologique. Les paramètres restants sont comme dans la figure 1A.

Explosivité dans la dynamique d'invasion des clusters en présence et en l'absence d'accumulation de mutations délétères.

(UNE) Un exemple représentatif de la dynamique de population d'un mutant antigénique en présence d'une accumulation de mutation délétère. La nouvelle souche antigénique envahit et s'établit avec succès, tout en excluant la souche résidente, caractéristique d'une transition de cluster antigénique réussie. Les paramètres du modèle sont N = 4 milliards, ?? = 1/30 ans −1 , ?? = 1/4 jours −1 , ?? = 0.10, s = 0.008, R0,k = 0 = 2,25, et ?? = 0,05. Dans cette simulation, le mutant antigénique apparaît dans un fond génétique avec k = 4 mutations délétères. (B) Un exemple représentatif de la dynamique de population d'un mutant antigénique en l'absence de mutations délétères. La nouvelle souche antigénique envahit de manière explosive, conduisant à son propre épuisement ainsi qu'à l'exclusion de la souche résidente. Les paramètres du modèle sont N = 4 milliards, ?? = 1/30 ans −1 , ?? = 1/4 jours −1 , R0 = 2,04, et ?? = 0,121. La valeur de R0 a été choisi de telle sorte qu'avant l'invasion du mutant antigénique, la fraction de la population d'hôtes sensible à l'infection et le nombre d'hôtes infectés soient les mêmes dans les deux simulations. Dans (B), la valeur de ?? a été choisi de telle sorte que Rm(t = 0) était le même dans les deux simulations (à une valeur de 1,13).

Les transitions de clusters antigéniques peuvent se produire via trois voies moléculaires distinctes

La figure 2C montre qu'un mutant antigénique peut exclure une souche antigénique résidente, à condition qu'elle se présente dans un bon fond génétique et qu'elle porte une mutation antigénique à effet important. Ceci est cohérent avec les études moléculaires détaillées de la grippe A/H3N2 qui ont montré que des changements d'acides aminés simples d'effet antigénique important peuvent précipiter une transition de cluster antigénique (Smith et al., 2004 Koel et al., 2013), bien que l'importance de la Le contexte génétique dans lequel survient la mutation antigénique n'a pas été discuté dans le cadre de ce travail. La transition de cluster BE92 à WU95, précipitée par un changement d'acide aminé de N à K au site 145, est un bon exemple d'une transition de cluster se produisant via une seule étape mutationnelle (Koel et al., 2013) (Figure 4A). Il est à noter que plusieurs clades ont été témoins de la substitution d'acides aminés 145NK avant qu'elle ne se produise dans le clade qui a fondé la lignée virale WU95. Nos modèles ci-dessus indiquent que l'échec de l'établissement de ces premiers clades 145K pourrait en principe être une conséquence de ce changement d'acide aminé N-à-K se produisant dans des antécédents génétiques insuffisamment bons, comme le suggèrent également Neher et al. (2014). D'autres explications de l'échec des premiers 145K à s'établir sont bien sûr possibles. Une de ces explications est que ces clades pourraient avoir circulé dans des emplacements spatiaux qui ne sont pas suffisamment bien connectés à l'échelle mondiale. Des travaux récents ont en outre souligné le rôle important que joue l'écologie spatiale dans l'établissement mondial de variants antigéniques (Russell et al., 2008 Lemey et al., 2014 Bedford et al., 2015), avec des résultats suggérant que l'Asie joue un rôle dominant dans l'approvisionnement de ces nouvelles variantes. Ainsi, si les premiers clades 145K n'étaient pas géographiquement bien situés, le contexte spatial (plutôt que le contexte génétique) de ces clades peut avoir conduit à leur échec à s'établir. Nous avons donc examiné les emplacements spatiaux des séquences des trois plus grands clades de 145K qui n'ont pas réussi à s'établir : les trois clades étaient géographiquement répandus, couvrant au moins deux continents. De plus, deux des trois clades contenaient des séquences d'Asie, bien que l'Asie ait été sous-échantillonnée au cours de cette période. Il est donc peu probable que ces premiers clades de 145K aient été géographiquement limités à des populations « puits ». Une autre explication de l'échec de ces premiers clades 145K à s'établir est que les niveaux d'immunité collective contre BE92 n'ont peut-être pas encore été suffisamment élevés pour entraîner un avantage sélectif suffisamment important pour ces lignées de type WU95. Compte tenu de ces explications alternatives, une étude expérimentale in vitro qui quantifie la fitness virale relative de ces lignées 145K serait donc nécessaire pour confirmer notre hypothèse de fond génétique.

Des phylogénies de la grippe cohérentes avec les trois voies moléculaires distinctes par lesquelles les transitions de clusters antigéniques peuvent se produire.

(UNE) Phylogénie de crédibilité maximale du clade (MCC) montrant la transition du cluster antigénique BE92-WU95, reconstruite à partir de séquences couvrant les années 1993-1997. La phylogénie montre une dynamique évolutive qui est cohérente avec une combinaison « jackpot » d'une grande mutation antigénique survenant dans un contexte génétique rare à faible charge. Des tests d'inhibition de l'hémagglutination ont indiqué expérimentalement qu'un seul changement d'acide aminé à effet antigénique important (145NK) était nécessaire pour précipiter la transition d'amas (Koel et al., 2013). Les nœuds sont colorés par l'acide aminé présent à ce site (145N = bleu 145K = rouge autre = noir). (B) Phylogénie du MCC montrant la transition du cluster antigénique WU95-SY97, reconstruite à partir de séquences couvrant les années 1995-1999. La phylogénie montre une dynamique évolutive compatible avec la voie moléculaire du changement antigénique en deux étapes conduisant à des transitions de grappes antigéniques, comme le montre la figure 5A. Des tests d'inhibition de l'hémagglutination ont indiqué expérimentalement que deux changements d'acides aminés (156KQ et 158EK) étaient nécessaires pour précipiter la transition d'amas (Koel et al., 2013). Les nœuds sont colorés par les acides aminés présents sur ces sites (156K158E = rouge 156Q158K = bleu autre = noir). Notez que les deux changements d'acides aminés se produisent sur la même branche interne courte, de sorte que cette transition apparemment rapide est peu susceptible d'être un artefact d'échantillonnage clairsemé. (C) Phylogénie du MCC montrant les transitions d'amas SY97-FU02 et FU02-CA04, reconstruites à partir de séquences couvrant les années 2001-2005. La phylogénie montre une dynamique évolutive compatible avec la voie moléculaire réassortis en deux étapes conduisant à des transitions de grappes antigéniques, comme le montre la figure 5B. Des tests d'inhibition de l'hémagglutination ont indiqué expérimentalement qu'un seul changement d'acide aminé (156QH) définissait antigéniquement la transition de cluster SY97-FU02 (Koel et al., 2013). Les nœuds sont colorés par l'acide aminé présent sur ce site (156Q = bleu 156H = rouge). La barre verticale montre le clade réassorti FU02. La lignée parentale non-hémagglutinine (HA) génétiquement distante de ce clade réassorti est également montrée. Phylogénies dans (UNEC) ont été déduits à l'aide de BEAST (Drummond et al., 2012) à partir de séquences HA1 complètes avec des dates d'échantillonnage spécifiées.

Bien que la combinaison « jackpot » soit une voie moléculaire viable pour précipiter une transition de cluster antigénique, la combinaison d'une grande mutation antigénique survenant dans un contexte génétique à faible charge devrait se produire rarement. Nous pouvons donc examiner s'il pourrait y avoir des voies moléculaires alternatives ouvertes aux mutants antigéniques qui produiraient de la même manière une transition de cluster réussie. Une possibilité est qu'une mutation antigénique de petite à moyenne taille plus courante se produise d'abord dans un bon fond génétique. Cela entraînerait une augmentation transitoire de ce mutant (figure 2A), augmentant ainsi le nombre d'individus infectés par le virus porteurs de quelques mutations délétères. Une mutation antigénique de grande taille moins courante pourrait alors se produire, s'appuyant efficacement sur le bon fond génétique que le plus petit mutant antigénique a gonflé. Étant donné que les mutations antigéniques plus petites ne peuvent circuler que de manière transitoire et accumuler des mutations délétères au cours de leur circulation, la grande mutation antigénique doit non seulement suivre, mais aussi suivre rapidement, la montée de la plus petite mutation antigénique pour que cette voie moléculaire produise une transition de cluster antigénique. Ce scénario est représenté sur la figure 5A, et d'un point de vue phylogénétique entraînerait l'apparition soudaine d'une lignée virale portant deux mutations antigéniques. Une analyse phylogénétique de la transition de cluster antigénique WU95-SY97 fournit un exemple empirique qui est cohérent avec cette voie moléculaire de renouvellement antigénique, avec une accumulation apparemment simultanée de deux changements d'acides aminés antigéniques (156KQ et 158EK) se produisant sur une courte branche de la reconstruction phylogénie (Koel et al., 2013) (Figure 4B).

Approches en deux étapes des transitions de clusters antigéniques.

(UNE) Une transition de cluster résultant de deux mutations antigéniques consécutives. Une petite mutation antigénique (?? = 0,003, ligne pointillée) survient d'abord dans un bon fond génétique (charge de mutation délétère k = 2) de la souche résidente (ligne pointillée). Peu de temps après, une deuxième mutation antigénique de plus grande taille (?? = 0,045, trait plein) se produit chez un individu infecté par le seul mutant antigénique. Cette séquence d'événements précipite une transition de cluster antigénique, le double mutant remplaçant la souche résidente et le mutant simple basse fréquence. Nous supposons que le degré d'échappement immunitaire est additif, de sorte que ?? entre la souche résidente et le double mutant est ?? = 0.048. (B) Une transition de cluster résultant d'un réassortiment viral intra-sous-typique. Une mutation antigénique de grande taille (?? = 0,06, ligne pointillée) survient d'abord dans un fond génétique moyen (k = 10) de la souche résidente (ligne pointillée). Après 2,5 ans de circulation, une co-infection qui conduit à la génération de mutants à faible charge (k = 4) se produit. Ce mutant à faible charge (ligne continue) remplace la souche résidente et le mutant antigénique porteur de charge moyenne, précipitant finalement une transition de cluster antigénique. Autres paramètres du modèle dans (UNE) et (B) sommes N = 4 milliards, ?? = 1/30 ans −1 , ?? = 1/4 jours −1 , R0,k = 0 = 2.25, ?? = 0,10, et s = 0.008.

Une troisième voie moléculaire qui pourrait en principe précipiter une transition de cluster antigénique est qu'une grande mutation antigénique survienne d'abord dans un fond génétique moyen et, au cours de sa circulation transitoire (figure 2D), se purge d'un grand nombre de mutations délétères. Cette purge pourrait résulter d'un réassortiment viral intra-sous-type ayant lieu chez un individu co-infecté par une souche appartenant au cluster résident et une souche appartenant au mutant antigénique circulant de manière transitoire.Même si les deux souches infectant cet individu porteraient probablement une charge moyenne de mutations délétères, il est hautement improbable qu'elles portent le même ensemble de mutations délétères si elles sont suffisamment éloignées phylogénétiquement. Le réassortiment des huit segments de gènes au sein de l'hôte co-infecté pourrait donc réduire significativement le nombre de mutations délétères portées par la descendance virale caractérisée comme appartenant au nouveau cluster antigénique. Une fois que la charge de mutation délétère a été largement éliminée, le virus réassorti augmenterait rapidement et provoquerait une transition de cluster antigénique (figure 5B). En effet, de nombreux cas historiques de réassortiment intra-sous-typique contribuant au renouvellement antigénique ont été documentés (Morens et al., 2009) ces cas ont été associés à des niveaux d'incidence élevés comme on pouvait s'y attendre en purgeant les mutations délétères. Une analyse phylogénétique de la transition de cluster SY97-FU02 fournit un exemple particulièrement convaincant qui est cohérent avec cette voie moléculaire de renouvellement antigénique. Dans cette transition de cluster, un virus caractérisé antigéniquement comme FU02 s'est réassorti avec un virus génétiquement distant caractérisé antigéniquement comme SY97 (Barr et al., 2005 Holmes et al., 2005) (Figure 4C). Cette lignée virale réassorti a beaucoup circulé en Australie et en Nouvelle-Zélande en 2003, puis aux États-Unis au cours de la saison grippale 2003-2004, causant une morbidité et une mortalité importantes (Barr et al., 2005). Bien que cette lignée virale puisse finalement avoir conduit au remplacement de la lignée virale FU02 non réassortis, ces deux lignées FU02 ont été exclues par le cluster antigénique CA04 ultérieur, qui semble provenir de la lignée FU02 non réassortis (Figure 4C) . Curieusement, la lignée CA04 portait non seulement une mutation HA de grande taille antigénique, mais également deux changements d'acides aminés dans son segment de gène de la polymérase qui ont amélioré la capacité de réplication (Memoli et al., 2009).

L'évolution antigénique dans le contexte de la variation de la valeur adaptative générée par des mutations délétères entraîne une phylogénie HA grêle, une co-circulation de variantes antigéniques et des taux d'attaque annuels élevés

Nos analyses ci-dessus se sont appuyées sur des modèles épidémiologiques simples pour avoir une intuition de l'impact des mutations délétères sublétales circulantes sur les modèles d'évolution antigénique de la grippe A/H3N2. Ces analyses indiquent que les charges de mutations délétères devraient abaisser le taux d'évolution antigénique (figure 1E). Sur la base de travaux de modélisation antérieurs (Koelle et al., 2006, 2009, 2010 Zinder et al., 2013), un taux d'évolution antigénique plus faible est connu pour restreindre la diversité génétique et antigénique et pourrait ainsi conduire à une phylogénie HA grêle. Nos analyses indiquent également que les charges de mutations délétères augmentent la taille moyenne des variants antigéniques qui établissent à long terme (Figure 1D) les modèles observés d'évolution antigénique ponctué (Smith et al., 2004) peuvent ainsi être mieux reproduits avec un modèle qui intègre sublétale mutations délétères que celle qui ignore ces mutations. De plus, nos analyses ci-dessus indiquent que les variants antigéniques peuvent atteindre des nombres appréciables même lorsque leur destin ultime est celui d'une circulation transitoire. Ce schéma de circulation transitoire indique la possibilité d'une co-circulation d'un nombre substantiel de variants antigéniques, comme le soutiennent les analyses statistiques des séquences HA de la grippe (Strelkowa et Lässig, 2012). Dans notre modèle, ces variants antigéniques n'ont pas nécessairement besoin de rivaliser fortement les uns avec les autres pour les hôtes sensibles pour qu'une seule lignée persiste. En l'absence de compétition exceptionnellement forte pour les hôtes sensibles, la co-circulation de ces variants antigéniquement distincts peut donc être capable de reproduire des taux d'attaque annuels élevés observés empiriquement (Organisation mondiale de la santé, 2014).

Pour déterminer si les phylogénies de l'HA grêle, la co-circulation des variants antigéniques et les taux d'attaque annuels élevés proviennent bien d'un modèle qui incorpore des mutations délétères, nous avons mis en œuvre un modèle phylodynamique qui simule l'apparition à la fois de mutations non antigéniques (largement délétères) et mutations antigéniques (« Matériels et méthodes »). Lorsqu'il est simulé avec des paramètres appropriés pour la grippe A/H3N2 chez l'homme, ce modèle donne une phylogénie HA grêle avec des virus à faible charge peuplant le tronc et des virus à charge plus élevée peuplant les pointes de la phylogénie (Figure 6A). Cette distribution des charges de mutations délétères sur la phylogénie simulée est cohérente avec le nombre excessif de substitutions non synonymes sur les branches d'arbre externes qui a été trouvée pour la grippe humaine A/H3N2 (Fitch et al., 1997 Pybus et al., 2007) et se pose parce que les mutations délétères contribuent à une fraction substantielle de la variance de fitness dans la population virale (Figure 7A).

Phylogénies virales à partir d'une simulation du modèle phylodynamique incorporant des mutations antigéniques et non antigéniques.

(UNE) Simulation de la phylogénie reproduisant la phylogénie HA grêle du H3N2, avec de faibles niveaux de diversité génétique et antigénique à long terme. Les lignées sont colorées en fonction de leurs charges de mutations délétères. (B) La phylogénie simulée montrée dans (UNE) avec des lignées colorées selon leur type antigénique. De même, les lignées colorées qui sont génétiquement distinctes sont antigéniquement distinctes (les couleurs ont été réutilisées en raison de leur nombre limité). (C) La phylogénie simulée montrée dans (UNE) avec des lignées colorées en fonction de la fraction de la population hôte susceptible d'être infectée par cette lignée (Seff/N). () La phylogénie simulée montrée dans (UNE) avec des lignées colorées selon leur taux net de reproduction R.

Dynamique de la variance de la condition physique, dynamique épidémiologique et temps jusqu'à l'ancêtre commun le plus récent pour une simulation du modèle phylodynamique incorporant des mutations antigéniques et non antigéniques.

(UNE) La fraction de la variation de la fitness virale (log) expliquée par les mutations délétères au cours du temps pour la simulation dont les phylogénies sont tracées sur la figure 6. La fraction non expliquée par la charge de mutation est due à la variation antigénique dans la population. (B) Dynamique épidémiologique simulée montrant la co-circulation de plusieurs variants antigéniques et des niveaux de prévalence soutenus au fil du temps pour cette même simulation. (C) Temps jusqu'à l'ancêtre commun le plus récent (tMRCA), calculé au fil du temps à partir des phylogénies illustrées à la figure 6.

La simulation du modèle phylodynamique reproduit en outre la co-circulation des variantes antigéniques (figures 6B, 7B), conformément aux conclusions selon lesquelles les lignées perdues subissent néanmoins une évolution antigénique appréciable (Strelkowa et Lässig, 2012) et que les niveaux de diversité antigénique au sein des clusters peuvent dépasser les distances antigéniques entre grappes (Smith et al., 2004). La simulation donne des niveaux de prévalence de 10 à 180 cas pour 100 000 personnes (figure 7B) et des taux d'attaque annuels d'environ 2 à 10 %, cohérents avec les estimations empiriques de l'incidence de la grippe (Organisation mondiale de la santé, 2014).

Malgré une vaste co-circulation de variants antigéniques, la phylogénie globale reste en forme d'échelle en raison des balayages sélectifs initiés par de rares mutations antigéniques de grande taille qui surviennent dans de bons antécédents génétiques. Cette dynamique est évidente en considérant conjointement la figure 6A et la figure 6C, la figure 6C montrant, pour chaque lignée, la fraction de la population hôte qui est susceptible d'être infectée par cette lignée. D'après ces figures, il est clair que le tronc de la phylogénie porte des virus à faible charge (figure 6A) qui ont un nombre élevé d'hôtes sensibles (figure 6C). Cette combinaison produit ensemble des virus à haute condition physique, comme l'indiquent épidémiologiquement leurs taux de reproduction nets R (Figure 6D). Ce sont ces virus qui s'établissent et forment ainsi le tronc de l'arbre. Ni une faible charge de mutations ni un nombre élevé d'hôtes sensibles ne suffisent à eux seuls à générer une lignée virale suffisamment adaptée pour assurer son succès évolutif à long terme.

L'inspection de la figure 6C montre également que les lignées de tronc gagnent brusquement des hôtes sensibles. Ces gains soudains sont le résultat de mutations antigéniques uniques et importantes qui, lorsqu'elles se produisent dans de bons antécédents génétiques, initient les balayages sélectifs qui limitent finalement la diversité génétique de la grippe. La façon dont ces balayages sélectifs affectent les niveaux de diversité génétique permanente dans la population virale est illustrée à la figure 7C, où nous utilisons le temps jusqu'à l'ancêtre commun le plus récent (tMRCA) de toutes les lignées circulantes comme indicateur de la diversité génétique totale. Ce graphique tMRCA reproduit les caractéristiques quantitatives du graphique tMRCA de la grippe A/H3N2 présenté dans Bedford et al. (2011), y compris sa variation interannuelle et les baisses importantes observées de tMRCA suite à l'émergence de nouveaux amas antigéniquement très distincts.

L'importance des mutations délétères dans la limitation de la diversité génétique et antigénique de la grippe peut être illustrée davantage en simulant le modèle phylodynamique sous l'hypothèse de leur absence. Ces simulations donnent très rapidement une diversité génétique et antigénique explosive (figure 8A) et, par conséquent, des niveaux de prévalence qui augmentent généralement avec le temps (figure 8B). Il est rassurant de constater que cette découverte est cohérente avec les prédictions des précédents travaux de modélisation de la grippe incorporant uniquement l'immunité spécifique à la souche (Ferguson et al., 2003).

Simulations du modèle phylodynamique en l'absence de charge mutationnelle délétère.

(UNE) Phylogénie simulée montrant une diversité génétique et antigénique explosive sur une période de 20 ans. Les lignées sont colorées en fonction de leur type antigénique, les lignées de même couleur qui sont génétiquement distinctes étant antigéniquement distinctes (les couleurs ont été réutilisées en raison de leur nombre limité). (B) Dynamique épidémiologique simulée montrant des niveaux de prévalence généralement croissants au fil du temps.

Étant donné que la sélection purificatrice à elle seule est connue pour réduire la diversité génétique (Charlesworth et al., 1993 Walczak et al., 2012), nous avons en outre simulé le modèle phylodynamique en supposant l'absence de mutations antigéniques. Dans ces simulations, nous avons incorporé de manière phénoménologique la dérive antigénique en simulant la dynamique sensible-infectée-récupérée-sensible (SIRS) de telle sorte que les niveaux de prévalence étaient similaires à ceux indiqués sur la figure 7B. Par rapport aux résultats présentés sur la figure 6, ces simulations ont donné lieu à des niveaux significativement plus élevés de diversité génétique (figure 9A) et des tMRCA plus longs (figure 9B). Cela indique que la sélection purificatrice à elle seule ne rend pas compte des phylogénies grêles illustrées à la figure 6. C'est plutôt l'évolution antigénique dans le contexte de la variation de la valeur adaptative générée par des mutations délétères qui contraint la phylogénie virale.

Simulations du modèle phylodynamique en l'absence de mutations antigéniques.

(UNE) Phylogénie simulée sous une paramétrisation sans mutations antigéniques, montrant une diversité génétique augmentant généralement avec le temps. (B) Temps jusqu'à l'ancêtre commun le plus récent (tMRCA) calculé au fil du temps à partir de la phylogénie indiquée dans (UNE).

Bien que les simulations ci-dessus démontrent qu'un modèle incorporant à la fois des mutations antigéniques et délétères peut reproduire la phylogénie grêle de la grippe A/H3N2, ses schémas de co-circulation antigénique et ses taux d'attaque annuels élevés, un certain nombre de paramètres nécessitant une spécification ne sont pas bien caractérisés empiriquement. . Il s'agit notamment des paramètres évolutifs du modèle : le taux de mutation délétère ??, le coût de remise en forme des mutations délétères s, et le taux de mutation antigénique ??antigénique. Sur la figure 10, nous montrons comment la dynamique évolutive et épidémiologique des simulations du modèle dépend de ces trois paramètres. Plus précisément, nous faisons varier un paramètre tout en gardant les deux paramètres restants fixes. Pour chaque ensemble de paramètres considéré, nous effectuons 20 simulations pour déterminer la gamme de dynamique prédite sous une seule paramétrisation. Pour chaque simulation, nous quantifions la dynamique évolutive du virus en traçant le tMRCA minimum et maximum calculé sur une période continue de 10 ans (années 15 à 25 de la simulation) comme mesure de l'étendue de la diversité génétique dans la population virale. Pour quantifier la dynamique épidémiologique du virus, nous traçons les taux d'attaque annuels minimum et maximum sur cette même période. La figure 10A montre qu'en l'absence de mutations délétères (?? = 0) les simulations du modèle donnent une diversité virale explosive, avec un tMRCA maximal compris entre 5 et 25 ans. Les augmentations observées de la diversité génétique et antigénique virale entraînent des taux d'attaque annuels maximaux irréalistes, de l'ordre de 15 à 45 % (figure 10B). Simulés sous cette paramétrisation, les résultats montrés sur les figures 8A, B sont représentatifs de ces résultats. Avec l'augmentation des taux de mutations délétères, les MRCA maximales diminuent, tout comme les taux d'attaque annuels maximaux (Figure 10A, B). Pour ?? des valeurs de 0,10 et plus, les taux d'attaque annuels documentés empiriquement peuvent être reproduits de manière cohérente. Les tMRCA maximales et minimales sont mieux reproduites pour ?? valeurs comprises entre 0,10 et 0,15.

Sensibilité des dynamiques évolutives et épidémiologiques aux paramètres du modèle phylodynamique.

Sous-parcelles (UNE, B) montrent la sensibilité du modèle au taux de mutation délétère ??. Sous-parcelles (C, ) montrent la sensibilité du modèle au coût de fitness des mutations délétères s. Sous-parcelles (E, F) montrent la sensibilité du modèle au taux de mutation antigénique ??antigénique. La rangée du haut montre les temps maximum (points rouges) et minimum (points noirs) jusqu'à l'ancêtre commun le plus récent (tMRCA) pour 20 simulations indépendantes. La ligne pointillée rouge indique le MRCA maximal déduit d'une analyse phylogénétique de l'HA de la grippe A/H3N2 (Bedford et al., 2011) la ligne pointillée noire indique le MRCA minimal déduit de cette même analyse. La rangée du bas montre les taux d'attaque annuels maximum (points rouges) et minimum (points noirs) pour les 20 mêmes simulations. La ligne pointillée rouge indique une estimation du taux d'attaque annuel maximum pour la grippe A/H3N2 la ligne pointillée noire indique une estimation du taux d'attaque annuel minimum pour la grippe A/H3N2. Ces valeurs sont basées sur des estimations du taux d'attaque annuel chez les adultes de 5 à 10 %, de sorte que le taux d'attaque annuel maximum est de l'ordre de 10 %, et le taux d'attaque annuel minimum est indiqué à 1 % (ce qui correspondrait à des années de circulation négligeable de ce sous-type de grippe). Chaque simulation a été exécutée pendant 28 ans, et les MRCA minimales et maximales et les taux d'attaque ont été calculés à partir des années 15 à 25 de la simulation. Dans les sous-parcelles (UNE) et (B), ?? est varié, s = 0,008 et ??antigénique = 0,00075. Dans les sous-parcelles (C) et (), ?? = 0.10, s est varié et ??antigénique = 0,00075. Dans les sous-parcelles (E) et (F), ?? = 0.10, s = 0,008, et ??antigénique est varié. Toutes les autres valeurs de paramètre sont répertoriées dans la Figure 6.

La figure 10C,D montre les effets évolutifs et épidémiologiques du coût de remise en forme des mutations délétères, s. Il est clair à partir de ces graphiques que ni le maximum moyen ni le minimum moyen de tMRCA à travers les simulations ne dépendent fortement de s (Figure 10C). Cependant, la plage des valeurs maximales de tMRCA est considérablement plus élevée à des niveaux inférieurs. s valeurs (figure 10C). Cela peut être dû au fait que les balayages sélectifs devraient se produire plus rarement à des niveaux inférieurs. s valeurs (figure 1E), telles que la population virale est homogénéisée moins fréquemment à ces valeurs inférieures, conduisant à des valeurs de tMRCA plus élevées. Cette explication est cohérente avec les taux d'attaque annuels légèrement inférieurs à s valeurs (Figure 10D) : lorsque le taux d'évolution antigénique est plus lent, les individus ne peuvent pas être réinfectés aussi rapidement et donc les taux d'attaque annuels seraient plus faibles. Malgré la dépendance des dynamiques évolutives et épidémiologiques sur s, la figure 10C,D montre qu'un large éventail de s valeurs donne une dynamique qui est cohérente avec la dynamique de la grippe A/H3N2 chez les humains.

Enfin, la figure 10E,F montre la sensibilité du modèle au taux de mutation antigénique ??antigénique. En l'absence d'évolution antigénique (??antigénique = 0), les MRCA maximales sont significativement plus élevées que celles documentées empiriquement (figure 10E) et les taux d'attaque annuels maximaux ne dépassent pas 3,8 % (figure 10F). Ces résultats sont cohérents avec la figure 9, qui indique qu'une phylogénie virale grêle ne peut pas être reproduite sous la seule sélection purificatrice dans un modèle paramétré pour la grippe. (Le modèle de la figure 9 diffère légèrement du modèle paramétré avec ??antigénique = 0, dont les simulations sont illustrées à la figure 10E,F : la figure 9 montre les résultats de simulation d'un modèle SIRS qui donne des taux d'attaque annuels cohérents avec ceux observés empiriquement pour la grippe les résultats illustrés à la figure 10E,F sous ??antigénique = 0 utiliser le même paramétrage que dans la figure 6, à l'exception de ??antigénique, et ainsi simuler un modèle SIR simple. Dans les deux cas, la sélection purificatrice seule ne peut pas reproduire une phylogénie grêle.) ??antigénique valeurs, les tMRCA diminuent et les taux d'attaque annuels augmentent jusqu'à des valeurs documentées empiriquement. Ces graphiques indiquent en outre que la dynamique évolutive et épidémiologique de la grippe peut être reproduite sur une large gamme de taux de mutation antigénique tant que le taux dépasse une certaine valeur minimale. Enfin, prises ensemble, la figure 10A,B,E,F indique à nouveau que c'est l'interaction entre les mutations d'échappement immunitaire délétères et avantageuses qui produit systématiquement une phylogénie grêle et des taux d'attaque annuels élevés. Ni les mutations délétères ni les mutations d'échappement immunitaire ne parviennent à elles seules à reproduire ces caractéristiques dynamiques de la grippe.


Réponse anticorps focalisée à la grippe liée à la dérive antigénique

1 Division des maladies infectieuses pédiatriques, Département de pédiatrie, Hôpital pour enfants de Chang Gung, Ville de Taoyuan, Taïwan.

2 Unité d'immunologie humaine, Weatherall Institute of Molecular Medicine, Université d'Oxford, John Radcliffe Hospital, Oxford, Royaume-Uni.

3 Faculté de médecine, Université Chang Gung, ville de Taoyuan, Taïwan.

4 Crick Worldwide Influenza Centre, The Francis Crick Institute, Mill Hill Laboratory, The Ridgeway, Mill Hill, Londres, Royaume-Uni.

Adressez la correspondance à : Alain R. Townsend, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, OX3 9DS, Royaume-Uni. Téléphone : 44.1865.222328 Courriel : [email protected]

Note d'auteur : Kuan-Ying A. Huang et Pramila Rijal ont contribué à parts égales à ce travail.

1 Division des maladies infectieuses pédiatriques, Département de pédiatrie, Hôpital pour enfants de Chang Gung, Ville de Taoyuan, Taïwan.

2 Unité d'immunologie humaine, Weatherall Institute of Molecular Medicine, Université d'Oxford, John Radcliffe Hospital, Oxford, Royaume-Uni.

3 Faculté de médecine, Université Chang Gung, ville de Taoyuan, Taïwan.

4 Crick Worldwide Influenza Centre, The Francis Crick Institute, Mill Hill Laboratory, The Ridgeway, Mill Hill, Londres, Royaume-Uni.

Adressez la correspondance à : Alain R. Townsend, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, OX3 9DS, Royaume-Uni. Téléphone : 44.1865.222328 Courriel : [email protected]

Note d'auteur : Kuan-Ying A. Huang et Pramila Rijal ont contribué à parts égales à ce travail.

1 Division des maladies infectieuses pédiatriques, Département de pédiatrie, Hôpital pour enfants de Chang Gung, Ville de Taoyuan, Taïwan.

2 Unité d'immunologie humaine, Weatherall Institute of Molecular Medicine, Université d'Oxford, John Radcliffe Hospital, Oxford, Royaume-Uni.

3 Faculté de médecine, Université Chang Gung, ville de Taoyuan, Taïwan.

4 Crick Worldwide Influenza Centre, The Francis Crick Institute, Mill Hill Laboratory, The Ridgeway, Mill Hill, Londres, Royaume-Uni.

Adressez la correspondance à : Alain R. Townsend, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, OX3 9DS, Royaume-Uni. Téléphone : 44.1865.222328 Courriel : [email protected]

Note d'auteur : Kuan-Ying A. Huang et Pramila Rijal ont contribué à parts égales à ce travail.

Trouvez des articles de Schimanski, L. dans : JCI | PubMed | Google Scholar

1 Division des maladies infectieuses pédiatriques, Département de pédiatrie, Hôpital pour enfants de Chang Gung, Ville de Taoyuan, Taïwan.

2 Unité d'immunologie humaine, Weatherall Institute of Molecular Medicine, Université d'Oxford, John Radcliffe Hospital, Oxford, Royaume-Uni.

3 Faculté de médecine, Université Chang Gung, ville de Taoyuan, Taïwan.

4 Crick Worldwide Influenza Centre, The Francis Crick Institute, Mill Hill Laboratory, The Ridgeway, Mill Hill, Londres, Royaume-Uni.

Adressez la correspondance à : Alain R. Townsend, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, OX3 9DS, Royaume-Uni. Téléphone : 44.1865.222328 Courriel : [email protected]

Note d'auteur : Kuan-Ying A. Huang et Pramila Rijal ont contribué à parts égales à ce travail.

1 Division des maladies infectieuses pédiatriques, Département de pédiatrie, Hôpital pour enfants de Chang Gung, Ville de Taoyuan, Taïwan.

2 Unité d'immunologie humaine, Weatherall Institute of Molecular Medicine, Université d'Oxford, John Radcliffe Hospital, Oxford, Royaume-Uni.

3 Faculté de médecine, Université Chang Gung, ville de Taoyuan, Taïwan.

4 Crick Worldwide Influenza Centre, The Francis Crick Institute, Mill Hill Laboratory, The Ridgeway, Mill Hill, Londres, Royaume-Uni.

Adressez la correspondance à : Alain R. Townsend, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, OX3 9DS, Royaume-Uni. Téléphone : 44.1865.222328 Courriel : [email protected]

Note d'auteur : Kuan-Ying A. Huang et Pramila Rijal ont contribué à parts égales à ce travail.

1 Division des maladies infectieuses pédiatriques, Département de pédiatrie, Hôpital pour enfants de Chang Gung, Ville de Taoyuan, Taïwan.

2 Unité d'immunologie humaine, Weatherall Institute of Molecular Medicine, Université d'Oxford, John Radcliffe Hospital, Oxford, Royaume-Uni.

3 Faculté de médecine, Université Chang Gung, ville de Taoyuan, Taïwan.

4 Crick Worldwide Influenza Centre, The Francis Crick Institute, Mill Hill Laboratory, The Ridgeway, Mill Hill, Londres, Royaume-Uni.

Adressez la correspondance à : Alain R. Townsend, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, OX3 9DS, Royaume-Uni. Téléphone : 44.1865.222328 Courriel : [email protected]

Note d'auteur : Kuan-Ying A. Huang et Pramila Rijal ont contribué à parts égales à ce travail.

Trouvez des articles de McCauley, J. dans : JCI | PubMed | Google Scholar

1 Division des maladies infectieuses pédiatriques, Département de pédiatrie, Hôpital pour enfants de Chang Gung, Ville de Taoyuan, Taïwan.

2 Unité d'immunologie humaine, Weatherall Institute of Molecular Medicine, Université d'Oxford, John Radcliffe Hospital, Oxford, Royaume-Uni.

3 Faculté de médecine, Université Chang Gung, ville de Taoyuan, Taïwan.

4 Crick Worldwide Influenza Centre, The Francis Crick Institute, Mill Hill Laboratory, The Ridgeway, Mill Hill, Londres, Royaume-Uni.

Adressez la correspondance à : Alain R. Townsend, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, OX3 9DS, Royaume-Uni. Téléphone : 44.1865.222328 Courriel : [email protected]

Note d'auteur : Kuan-Ying A. Huang et Pramila Rijal ont contribué à parts égales à ce travail.

Trouvez des articles de Daniels, R. dans : JCI | PubMed | Google Scholar

1 Division des maladies infectieuses pédiatriques, Département de pédiatrie, Hôpital pour enfants de Chang Gung, Ville de Taoyuan, Taïwan.

2 Unité d'immunologie humaine, Weatherall Institute of Molecular Medicine, Université d'Oxford, John Radcliffe Hospital, Oxford, Royaume-Uni.

3 Faculté de médecine, Université Chang Gung, ville de Taoyuan, Taïwan.

4 Crick Worldwide Influenza Centre, The Francis Crick Institute, Mill Hill Laboratory, The Ridgeway, Mill Hill, Londres, Royaume-Uni.

Adressez la correspondance à : Alain R. Townsend, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, OX3 9DS, Royaume-Uni. Téléphone : 44.1865.222328 Courriel : [email protected]

Note d'auteur : Kuan-Ying A. Huang et Pramila Rijal ont contribué à parts égales à ce travail.

Trouvez des articles de Townsend, A. dans : JCI | PubMed | Google Scholar

On pense que la pression sélective qui entraîne les changements antigéniques dans les virus de la grippe provient de la réponse immunitaire humaine. Ici, nous avons caractérisé le répertoire des cellules B d'un donneur précédemment vacciné dont le sérum avait une activité neutralisante réduite contre les virus du clade 6B H1N1pdm09 récemment évolués. Alors que la réponse était nettement polyclonale, 88 % des clones n'ont pas reconnu les virus du clade 6B, cependant, la capacité de neutraliser la grippe A/USSR/90/1977, à laquelle le donneur aurait été exposé dans l'enfance, a été conservée. La sélection in vitro de variantes virales avec des anticorps monoclonaux représentatifs a révélé qu'un seul remplacement d'acide aminé au niveau du résidu K163 du site antigénique Sa, caractéristique des virus du clade 6B, était responsable de la résistance à la neutralisation par plusieurs anticorps monoclonaux et le sérum du donneur. Le résidu K163 se trouve dans une partie d'une surface conservée commune aux hémagglutinines des virus H1N1 de 1977 et 2009. La vaccination avec l'hémagglutinine de 2009 a induit une réponse anticorps étroitement focalisée sur cette surface commune qui est capable de sélectionner les variants actuels de dérive antigénique dans les virus grippaux H1N1pdm09. De plus, le remplacement des acides aminés à K163 n'a pas été mis en évidence par les antisérums de furet standard. Les anticorps monoclonaux humains peuvent être un complément utile aux antisérums de furet pour détecter la dérive antigénique dans les virus de la grippe.

Les virus grippaux circulant chez l'homme mutent et modifient leur antigénicité à un rythme qui nécessite une mise à jour fréquente des vaccins sous-unitaires. Ce processus de dérive antigénique nécessite une collaboration mondiale, organisée par l'intermédiaire de l'OMS, pour surveiller la parenté antigénique de nouveaux virus et sélectionner les plus appropriés à inclure dans des vaccins régulièrement mis à jour (1). On pense que la force sélective à l'origine de l'évolution de la grippe chez l'homme est la réponse des anticorps neutralisants. Cependant, cela soulève un paradoxe, car la réponse anticorps est polyclonale et est en principe capable de neutraliser le virus en de multiples sites sur la glycoprotéine hémagglutinine (HA). Jusqu'à 12 mutations séquentielles dans l'hémagglutinine peuvent être nécessaires pour abroger complètement la neutralisation par un sérum immun fort (2). Cela nécessiterait une mutation à plusieurs positions dans HA simultanément pour que le virus s'échappe dans la nature, ce qui devrait être un événement très rare.

Deux mécanismes alternatifs ont été suggérés pour résoudre le paradoxe. Des substitutions adsorbantes d'acides aminés ont été décrites qui peuvent globalement réduire le pouvoir neutralisant d'un sérum (3). On pense que cela est médié par les substitutions provoquant une augmentation de l'affinité de liaison de l'hémagglutinine pour son récepteur acide sialique (4). La sélection de variants de virus de ce type a été démontrée dans un modèle animal d'infection grippale (4, 5) et également définie avec des variants résistants à la neutralisation sélectionnés in vitro avec certains anticorps monoclonaux (3, 6). Cependant, une analyse récente de l'évolution des virus H3N2 a démontré que l'affinité de liaison de l'hémagglutinine H3 a considérablement diminué depuis l'apparition des virus H3N2 chez l'homme en 1968, ce qui suggère que des mécanismes supplémentaires pourraient être à l'œuvre (7).

La deuxième possibilité est que, chez certains humains, la réponse anticorps peut être focalisée sur une sous-région de l'hémagglutinine à un point tel qu'elle devient fonctionnellement monoclonale et peut sélectionner des virus avec des mutations ponctuelles. Les premières preuves de cela provenaient de la découverte d'une neutralisation réduite des virus avec des mutations ponctuelles (8 - 12) et d'une inhibition sélective par les sérums de la liaison par des fragments Fab d'anticorps monoclonaux spécifiques de l'hémagglutinine (13). Un article récent a identifié une seule substitution d'acide aminé (K163Q dans notre numérotation) comme étant responsable de la réactivité sérologique réduite avec les virus H1N1pdm09 2013-2014 chez jusqu'à 42% des adultes d'âge moyen nés entre 1965 et 1979, qui auraient été exposés aux virus H1N1 qui ont réapparu en 1977 (14).

Ces études n'ont pas abordé la base clonale des réponses d'anticorps focalisées chez l'homme ni montré que les anticorps dans les sérums étaient capables de sélectionner des variantes antigéniques des virus de la grippe. Nous avons abordé ce problème par l'analyse de 157 anticorps monoclonaux isolés d'un donneur avec une réactivité sérologique réduite aux virus de la grippe du clade 6B H1N1pdm09 récemment évolués. Nous montrons que la réponse était nettement polyclonale et présentait une réactivité croisée variable pour les virus H1N1 saisonniers récents. Cependant, 88 % des anticorps isolés n'ont pas reconnu les virus du clade 6B, alors que tous ces clones ont neutralisé A/USSR/90/1977 (H1N1), qui a circulé pendant l'enfance du donneur. Des virus résistants isolés in vitro avec des anticorps monoclonaux représentatifs ont sélectionné des substitutions d'acides aminés à HA K163 qui correspondaient à une substitution de définition dans le clade 6B récemment évolué. Les virus avec cette substitution unique dans HA étaient résistants à la neutralisation par plusieurs anticorps monoclonaux du donneur et du sérum du donneur.

La lysine 163 se trouve dans un patch localisé et conservé de résidus de surface dans le site antigénique Sa qui sont communs aux virus H1N1 de 1977 circulant dans l'enfance du donneur et au virus H1N1pdm09 (15). Cela suggère que les anticorps amorcés par ce patch de surface commun peuvent avoir été sélectivement rappelés et développés par exposition à l'hémagglutinine H1N1pdm09 pour former une réponse d'anticorps focalisée, capable de sélectionner des variants antigéniques avec des substitutions à K163. Nos résultats correspondent à la réponse ciblée des anticorps dans un sous-ensemble d'humains avec l'évolution récente des virus grippaux du clade 6B H1N1pdm09. Ils montrent également que la sélection de variants de virus avec des anticorps monoclonaux humains isolés d'individus vaccinés ou infectés peut être en mesure de prédire les sites de dérive antigénique future dans les virus de la grippe A. Enfin, les substitutions K163 dans les virus du clade 6B H1N1pdm09 n'ont pas été signalées comme une dérive antigénique significative par les antisérums de furet standard. Des panels d'anticorps monoclonaux humains peuvent être un complément utile aux antisérums de furet dans la détection de la dérive antigénique et dans la sélection de virus à inclure dans les vaccins antigrippaux.

Réponse en anticorps spécifiques du virus de la grippe après vaccination. Un volontaire adulte en bonne santé (appelé donneur H) avait reçu 3 fois le vaccin antigrippal trivalent inactivé depuis 2008. Les vaccins contenaient les antigènes indiqués dans le tableau 1.

Historique vaccinal et contenu vaccinal

La figure 1 montre les titres de neutralisation récupérés du donneur H pour les anciens virus saisonniers H1, H3, pandémique H1N1 2009 et H5. Avant la première vaccination en novembre 2008, le plasma contenait des anticorps à faible titre contre tous les sous-types de grippe A dépistés. Six mois après la première dose de vaccin, une réponse a été observée contre les anciens virus saisonniers H1 (A/Brisbane/59/2007) et H3 (A/Victoria/361/2011) qui n'ont pas neutralisé de manière croisée H1N1pdm09 ou H5. Ce profil de réactivité s'est maintenu 2 ans après la deuxième vaccination. La troisième vaccination, le 10 novembre 2011, contenait pour la première fois H1N1pdm09 HA. Un jour après la troisième vaccination, une faible réponse au virus H1N1pdm09 a été détectée. Cela peut avoir reflété une exposition plus précoce ou une réponse très précoce à la vaccination. Douze jours après la vaccination, une très forte réponse à la grippe H1N1pdm09 a été détectée, qui était associée à une faible augmentation du titre des virus H3 et aucun changement du titre à H1 saisonnier. Le titre d'une grippe pseudotypée H5, bien que faible, a été augmenté par le virus H1pdm09 par rapport aux niveaux avant la vaccination.

Les titres de neutralisation sérologique des anciens virus grippaux saisonniers H1, H3, H1pdm09 et H5 pseudotypés chez le donneur H avant et après la vaccination antigrippale saisonnière trivalente. Le donneur H a reçu les vaccins antigrippaux 2008-2009, 2009-2010 et 2011-2012, qui contiennent des antigènes des virus répertoriés dans le tableau 1. Le dosage a été effectué en double et les moyennes sont indiquées. Les virus grippaux pseudotypés sont plus sensibles aux anticorps souches que les virus de type sauvage. VTI, grippe saisonnière trivalente.

Ce sérum a ensuite été testé sur une sélection de virus du clade 6B H1N1pdm09 récemment évolués. Nous avons trouvé une réduction substantielle du titre de neutralisation entre 4 et 8 fois sur les virus du clade 6B. Pour analyser la base clonale de ce titre réduit, nous avons isolé des anticorps monoclonaux des plasmablastes du donneur prélevés 7 jours après la vaccination.

Identification des cellules B spécifiques de HA. Nous avons précédemment confirmé que les plasmablastes spécifiques au virus de la grippe sont induits de manière transitoire en grand nombre dans le sang périphérique au cours de la première semaine après la vaccination avec les anciens virus saisonniers H1N1 et H1N1pdm09 inactivés et la fréquence des plasmablastes spécifiques au virus de la grippe est significativement corrélée avec le niveau de neutralisation. réponse en anticorps (16 – 18). Au jour 7 après la vaccination du donneur H, l'analyse des marqueurs de surface par cytométrie en flux a révélé une population distincte de plasmablastes (définis comme des cellules CD3 – CD20 lo CD20 – CD19 + CD27 hi CD38 hi), qui représentaient 0,9 % du total des lymphocytes périphériques. Nous avons ensuite détecté des cellules spécifiques de l'hémagglutinine par ELISpot de cellules B ex vivo avec de l'hémagglutinine purifiée et mesuré les fréquences des plasmablastes IgG spécifiques de l'HA H1N1pdm09 (A/Californie/07/2009) et Eng195 (A/England/195/2009) à 425 et 315 par million de cellules mononucléées du sang périphérique.

Liaison de HA recombinante à l'Ig G1 transmembranaire. Dans ces expériences, les molécules HA n'avaient aucune mutation pour abolir la liaison à l'acide sialique, comme décrit par Whittle et al. (19). Contrairement à la méthode de Whittle, dans laquelle l'HA trimérique a été combiné en excès avec de la streptavidine pour former des oligomères avant la coloration, nous avons coloré séquentiellement avec de l'hémagglutinine suivie d'ExtrAvidin. Pour la spécificité, cette méthode repose sur la haute affinité de l'anticorps lié à la membrane pour l'HA, par rapport à la faible affinité des trimères HA simples pour l'acide sialique.

Nous avons d'abord établi que nos préparations de HA soluble recombinant pouvaient détecter des Ig transmembranaires spécifiques exprimées à la surface cellulaire. Comme le montre la figure supplémentaire 1A, rangée 4 (matériel supplémentaire disponible en ligne avec cet article doi:10.1172/JCI81104DS1), toutes les cellules transfectées avec les clones transmembranaires Ig G1 (TMIgG1) reconstruits ont été colorées avec un réactif anti-IgG. Les cellules ont ensuite été colorées avec du H3 recombinant marqué à la biotine (A/Victoria/361/2011 Figure supplémentaire 1A, rangée 2), H1N1pdm09 (A/England/195/2009 Figure supplémentaire 1A, rangée 1), H5 (A/Vietnam/ 1203/2004 Figure supplémentaire 1A, rangée 3), et H7 (A/Anhui/1/2013 Figure supplémentaire 1A, rangée 5) HA. Le H3 HA a coloré spécifiquement les cellules transfectées anti-H3 (Figure supplémentaire 1A, colonne 4) H1N1pdm09 HA a coloré les cellules exprimant TMIgG1 aux épitopes dans la tête et la tige de H1 HA (Figure supplémentaire 1A, colonnes 1 à 3) et la protéine H5 n'ont coloré que les cellules exprimant TMIgG1 spécifiques de la tige de H1N1pdm09 HA (Figure supplémentaire 1A, colonne 3) qui ont réagi de manière croisée avec le H5 HA. Le H7 HA n'a réussi à colorer aucune des cellules transfectées par TMIgG1 et a agi comme contrôle négatif (Figure supplémentaire 1A, rangée 5). Des résultats similaires ont été obtenus avec du HA spécifiquement marqué sur l'extrémité C-terminale ou marqué chimiquement de manière aléatoire avec de la biotine. Ces résultats ont établi que nos préparations de HA soluble contenaient des épitopes typiques de la tête et de la tige et pouvaient être utilisées pour colorer des cellules exprimant des IgG1 spécifiques de HA dans la membrane plasmique.

Tri spécifique des antigènes des plasmablastes. Le HA biotinylé de A/England/195/2009 a coloré environ 26 % des plasmablastes au jour 7 après la vaccination du donneur H pendant la saison grippale 2011-2012 (Figure supplémentaire 1B). Un total de 288 cellules colorées avec le HA ont été triées individuellement, et 167 cellules se sont révélées positives par PCR pour les chaînes lourdes et légères d'Ig. Ces 167 cellules ont été utilisées pour produire des anticorps monoclonaux humains (20). Sur les 167 anticorps, 157 se sont avérés se lier à l'HA par un ou plusieurs des éléments suivants : coloration des cellules transfectées par HA, ELISA, inhibition de l'hémagglutination (HAI), neutralisation spécifique ou liaison en Western blots. Chacun des 157 anticorps avait une séquence unique, qui a été identifiée comme une séquence productive par l'International Immunogenetics Information System (21).

Les 157 séquences uniques d'anticorps liant HA pourraient être divisées en 11 ensembles définis par leur utilisation d'une région variable de chaîne lourde particulière (VH) gènes (tableau 2) 150 des 157 séquences (96 %) étaient dérivées des 6 plus grands VH ensembles (figure 2A et tableau 2). Chaque VH L'ensemble était composé de plusieurs clones définis par des réarrangements VDJ spécifiques (figure 2A et tableau 2) dans la chaîne lourde, et chaque clone était encore diversifié par un modèle et une fréquence uniques de mutations somatiques. Dans chaque VHensemble apparenté, un clone avait tendance à dominer (tableau 2). Par exemple, au sein du VH 3-7, 73 des 88 anticorps appartiennent à un clone, qui s'est diversifié par mutation somatique (Figure supplémentaire 2). Ces clones sont définis par l'identité unique de leurs segments VDJ et de leurs cadres de lecture. Sélections de clones de chacun des 6 plus grands VH-les ensembles apparentés ont été étendus et leurs anticorps ont été purifiés et testés dans un essai quantitatif (voir Méthodes) pour la neutralisation d'une variété de virus (Figure 2).

Les 6 plus grands VHensembles d'anticorps se liant à HA dérivés de cellules B spécifiques à HA Eng195 du jour 7. (UNE) Le nombre moyen de VH remplacements de nucléotides et d'acides aminés dans les 6 plus grands ensembles d'anticorps se liant à l'HA. Les résultats représentatifs de HAI et MN des anticorps spécifiques à la tête (Head S), à réaction croisée de la tête (Head CR) et à réaction croisée de la tige (Stem CR) sont résumés dans la figure. –, négatif +, CE50

7 ng/ml pour la neutralisation du virus X179A (A/California/07/2009 H1pdm09). (B) Titres de neutralisation des anticorps spécifiques à la tête, à réaction croisée de la tête et à réaction croisée de la tige pour les anciens virus H1, H3, H1pdm09 et H5. Deux têtes H1, 15-2A06 et 19-4G05 ( 22 ), et 5 tiges réactives, FI6v3 ( 24 ), V3-2G6 ( 23 ), SF70-1F02 (25 ) et 05-2G02 et 09-3A01 (22), des anticorps de référence ont été inclus. Chaque symbole représente une mesure indépendante. Certaines mesures se chevauchent. Les titres MN ont été dosés au moins deux fois pour chaque anticorps. La CE moyenne50 pour la neutralisation des 6 plus grands ensembles d'anticorps de liaison à l'HA dans le test MN a été analysé par ANOVA à une voie, et un P une valeur inférieure à 0,05 a été considérée comme significative.

Ensemble de 157 séquences de liaison HA et productives

Plusieurs tests de neutralisation différents sont décrits dans la littérature, de sorte que les comparaisons quantitatives entre les ensembles de données sont difficiles. Pour une comparaison directe, nous avons inclus des échantillons de 7 anticorps publiés (figure 2B) (voir Méthodes et remerciements pour plus de détails). Deux anticorps ont largement réagi à la tête H1, 15-2A06 et 19-4G05 ( 22 ), et cinq anticorps ont réagi à la tige de l'HA, V3-2G6 ( 23 ), FI6v3 ( 24 ), SF70-1F02 (25 ) , et 05-2G02 et 09-3A01 ( 22 ). Les anticorps du donneur H ont neutralisé la grippe dans notre dosage quantitatif à des concentrations comparables aux anticorps de référence et ont montré des profils d'activités similaires aux divers isolats de virus. Six pour cent des clones (10 sur 157) ont été définis comme réagissant avec la tige HA sur la base de la compétition pour la liaison avec l'anticorps canonique réactif à la tige C179 (26, 27), de l'incapacité de bloquer l'agglutination des globules rouges et d'une large neutralisation, y compris notre exemple d'un VH Anticorps 3-23 (T3-5D) qui a reconnu les HA saisonniers et pandémiques H1, H5 et H3 récents (figure 2B). Trois autres anticorps étaient très étroitement liés en séquence à des anticorps souches définis et ont été classés comme « souches » dans le tableau 2. Quatre-vingt-huit pour cent des anticorps (138 sur 157) ont été capables d'inhiber l'hémagglutination et ont montré une réactivité moins large, compatible avec la liaison au domaine de la tête globulaire de HA. Les séquences de tous les anticorps nommés dans la figure 2B sont déposées dans la base de données GenBank (accessions KP231608-KP231649).

H1N1pdm09 Clones spécifiques à l'HA qui ne reconnaissent pas les virus H1N1 saisonniers récents. Cinquante-six pour cent (88 sur 157) des séquences étaient dérivées d'un V dominantH-ensemble lié, dans lequel la région variable Ig a été codée par VH 3-7, associé le plus souvent à JH 6*02/JH 3-16*01 et V?? 1-40*01/J?? 2*01 (tableau 2 et figure supplémentaire 2). Au moins 6 clones ont pu être identifiés dans cet ensemble sur la base de leurs réarrangements uniques du gène de la chaîne lourde VDJ, qui ont tous abouti à une longueur de CDR3 de 18 acides aminés (tableau 2). Un clone dominant représentait 73 des 88 séquences. Un dendrogramme de séquence d'acides aminés des régions VDJ (Figure supplémentaire 2) a révélé la diversité de ces séquences générées par des mutations somatiques de la région V (qui induisaient en moyenne 7 changements d'acides aminés par séquence) et des combinaisons clonales D-J. Ce résultat est très similaire aux conclusions de Krause et al. ( 28 ) et Jackson et al. ( 29 ), qui a identifié des ensembles de clones très similaires basés sur VH 3-7/JH 6 réarrangements chez les individus répondant au site Sa de H1N1pdm09 HA et ont discuté des preuves de la divergence intraclonale et de la convergence interclonale de ces séquences.

Le criblage initial a montré que les clones du VH 3-7 ont inhibé l'hémagglutination par le virus H1N1pdm09 (X179A A/California/07/2009). Trois exemples ont été développés et l'IgG1 purifiée a été titrée contre divers virus dans des tests HAI et de microneutralisation (MN). Les anticorps de ces clones étaient les plus puissants de tous ceux isolés, avec un EC50 pour neutraliser le virus H1N1pdm09 à des concentrations d'environ 7 ng/ml (

5 × 10 –11 M), mais ils n'ont pas réagi par HAI ou MN avec des virus H1 saisonniers récents (Figure 2 et Tableau 3).

MN de variants naturels et de virus variants sélectionnés par anticorps in vitro A

Pour identifier le site reconnu par ces VH 3-7*01 clones, variants du virus vaccinal X179A (contenant A/California/07/2009 HA) ont été sélectionnés avec le VH 3-7*01 anticorps T2-6A (voir Méthodes). Nous avons trouvé qu'une seule mutation codant pour la substitution K163E dans le HA dans le site antigénique Sa était associée à la perte de neutralisation et de liaison par cet anticorps et les membres apparentés du VH 3-7 (Figure 3 et Tableau 3). La substitution K163E correspond à K166E isolée par Krause et al. ( 28 ), avec leur VH 3-7*01 clone 4K8 dans le contexte de A/California/04/2009 HA (notre numérotation de séquence est celle utilisée dans les rapports annuels de l'OMS) (30).

Activité de liaison des anticorps spécifiques de la tête HA et réactifs croisés de la tête sur les cellules infectées par les virus variants. Une sélection de têtes spécifiques (VH 3-7, 3-33, 1-18) et tête à réaction croisée (VH 3-15) anticorps et contrôles, y compris l'anticorps souche T1-3B (VH 1-69), ont été testés pour la liaison aux cellules MDCK-SIAT1 infectées par des virus variants sélectionnés avec l'anticorps monoclonal T2-6A (VH 3-7) qui a sélectionné la substitution K163E, T3-4B (VH 3-15) qui a sélectionné K163Q, et le contrôle 2-12C (VH 5-51) qui a sélectionné (K130E/G170R). Le dosage a été effectué deux fois avec des résultats équivalents.

Deux autres VH-ensembles de séquences apparentés caractérisés par des réarrangements de VH 3-33 (12 sur 157) et VH 1-18 (20 sur 157) avait des propriétés similaires au VH 3-7 famille. Ils étaient également polyclonaux (tableau 2) et spécifiques de H1N1pdm09 (figure 2A) mais avaient tendance à nécessiter des concentrations plus élevées d'anticorps pour la neutralisation (figure 2B) et contenaient plus de mutations somatiques (figure 2A 21 ± 2 mutations pour VH 3-33 et 20 ± 3 mutations pour VH 1-18). Remarquablement, la neutralisation et la liaison par les représentants des deux ensembles d'anticorps ont été perdues pour le même variant K163E, sélectionné par le VH Clone 3-7*01 (Figure 3 et Tableau 3).

Anticorps dirigés contre H1 HA qui réagissent de manière croisée avec les anciennes souches saisonnières H1N1. Un quatrième ensemble dominant de clones (18 sur 157, 11%) (tableau 2), qui ont réagi de manière croisée presque également entre les virus saisonniers (A/Brisbane/59/2007) et H1N1pdm09 (A/California/07/2009) dans les IHA et les tests MN, a été caractérisé par des réarrangements de VH 3-15 (Figure 2 et Tableau 3). Une analyse plus poussée a révélé la neutralisation d'un large éventail d'anciens virus H1N1 saisonniers isolés entre 1995 et 2007 (tableau 3). Tous les VH 3 à 15 clones ont inhibé l'hémagglutination et n'ont pas été en mesure de rivaliser pour la liaison par l'anticorps spécifique de la tige C179 (26). Cela suggère que le VH Les anticorps 3-15 se lient à un épitope dans la tête des HA H1 conservés entre les anciens virus saisonniers récents et H1N1pdm09 (27). La CE moyenne50 pour la neutralisation d'une sélection de ces VH 3-15 anticorps dans le test MN était d'environ 70 ng/ml pour X179A (figure 2B), significativement plus élevé que celui pour le VH 3-7 famille (ANOVA, P < 0,001). Le nombre moyen de mutations somatiques dans le 18 VH 3-15 séquences était de 25 ± 4 (figure 2A), ce qui était également significativement plus élevé que celui de la VH 3-7 clones spécifiques H1N1pdm09 (ANOVA, P < 0,001).

Pour identifier le site reconnu par ces anticorps plus largement réactifs, nous avons sélectionné des mutants de X179A avec un V représentatifH 3-15*01 anticorps, T3-4B. Il a sélectionné une mutation exactement à la même position, K163Q, que le VH 3-7*01 clone T2-6A, qui a sélectionné K163E.

Anticorps dirigés contre la tête globulaire concentrés sur K163. Nous avons ensuite testé une sélection d'anticorps du 4 VH-ensembles apparentés, représentant 138 des 157 des anticorps isolés du donneur H, pour la liaison et la neutralisation des virus qui contenaient des substitutions K163E et K163Q (la figure 3 et le tableau 3 résument les résultats). Les substitutions K163E et K163Q ont aboli la neutralisation (tableau 3) et la liaison (figure 3) par les 4 ensembles d'anticorps (VH 3-7, 3-33, 1-18 et 3-15) reconnaissant la tête globulaire. Les deux mutations ont également empêché la neutralisation par les 2 anticorps de contrôle largement réactifs reconnaissant la tête globulaire, 15-2A06 et 19-4G05 (22), qui sont codés par différents VH gènes (VH 1-2 et 3-74, respectivement), ce qui implique que ces 2 anticorps se lient à des épitopes étroitement liés. La substitution K163Q n'a inhibé que partiellement la liaison par l'anticorps témoin 19-4G05, mais cela était suffisant pour empêcher la neutralisation (figure 3 et tableau 3).

En revanche, un clone d'un individu différent, 2-12C (VH 5-51), n'a pas été affectée par les substitutions à K163E/Q dans les tests de neutralisation ou de liaison (figure 3 et tableau 3). L'anticorps 2-12C a sélectionné un virus variant avec les substitutions HA K130E et G170R. Cette variante a entraîné une perte de neutralisation et de liaison par l'anticorps de sélection mais était toujours sensible aux anticorps du donneur H qui étaient sensibles aux changements à K163, montrant que les sites de liaison des 2 anticorps étaient fonctionnellement indépendants. Par la suite, nous avons constaté qu'un variant antigénique (A/Bayern/69/2009) avec une seule substitution HA1 G155E (WHO Influenza Center February 2010 report ref. 30) présentait une reconnaissance considérablement réduite par l'anticorps 2-12C mais était sensible aux anticorps du donneur. H (tableau 3). Les substitutions K130E et G170R ont également empêché la neutralisation par un autre anticorps de contrôle, Q11A6 (VH 3-21) d'un donneur différent, avec un schéma de réactivité similaire à celui de 2-12C (tableau 3). La liaison de 2-12C aux cellules infectées avec les virus variants K163E/Q a été conservée intégralement (figure 3) mais a été abolie pour les cellules infectées avec son propre variant K130E/G170R. La liaison par Q11A6 était réduite sur le variant K130E/G170R (Figure 3), mais cela était associé à une perte complète de neutralisation (Tableau 3). En tant que contrôle positif supplémentaire, un V typiqueH L'anticorps réactif à la tige 1-69 HA produit par le donneur H a réagi avec tous les virus variants sélectionnés dans les tests de liaison aux cellules infectées (Figure 3).

La cartographie des substitutions sur une structure HA 3D (15) a montré que les positions 130 et 155, reconnues par le clone 2-12C, sont proches l'une de l'autre, bordant le site de liaison à l'acide sialique (en rouge sur la figure 4). En revanche, K163, reconnu par les représentants des 4 VH-les ensembles d'anticorps bloquant les récepteurs du donneur H et les 2 anticorps de contrôle largement réactifs, 15-2A06 et 19-4G05 (21), se mappent dans le site antigénique Sa de l'autre côté du domaine de la tête globulaire mais à une proximité raisonnable au site de liaison au récepteur (indiqué en bleu sur la figure 4). Cette séparation physique est cohérente avec des sites de liaison indépendants pour les anticorps respectifs. La substitution d'acide aminé G170R cosélectionnée par l'anticorps de contrôle 2-12C est susceptible d'être associée par coïncidence à K130E, car elle est largement séparée de K130 dans la structure et était absente dans la variante de dérive antigénique A/Bayern/69/2009, qui a également a montré une neutralisation réduite de 2-12C.

Cartographie des substitutions K163E/Q sélectionnées par T2-6A spécifique à la tête (VH 3-7) et tête à réaction croisée T3-4B (VH 3-15) anticorps. K130E, G155E et G170R (indiqués en rouge) ont entraîné une perte de liaison par l'anticorps témoin 2-12C. On pense que la substitution d'acide aminé G170R, cosélectionnée par l'anticorps témoin 2-12C, est associée par coïncidence à K130E. Le triangle orange indique la position du site de liaison de l'acide sialique. K163E/Q est représenté en bleu. Les mutations ont été mappées avec PYMOL version 1.7 sur PDB:3LZG (15).

Comme le montre le tableau 3, dans l'ensemble de VH 3 à 15 séquences étaient des membres partageant des réarrangements VDJ identiques et différant uniquement par des mutations somatiques qui pouvaient faire la distinction entre les virus dérivés des anciens virus H1 saisonniers dans le test MN. Par exemple, 3 sur 6 VH 3 à 15 anticorps ont perdu leur réactivité avec A/Beijing/262/1995, tout en conservant une réactivité avec A/Bayern/7/1995. Ces deux virus diffèrent à plusieurs endroits, dont K163N.

Réactivité avec les variants naturels de dérive antigénique du virus H1N1pdm09. Depuis 2009, les virus H1N1pdm09 isolés dans divers centres à travers le monde ont acquis un nombre important de mutations, conduisant à des substitutions d'acides aminés HA, mais n'ont pas subi de dérive antigénique majeure, comme déterminé par les antisérums de furet après infection dans le test HAI (WHO Influenza Rapport du Centre de février 2015 réf. 30, 31). Il était intéressant d'évaluer la réactivité des anticorps du donneur H avec les virus H1N1pdm09 récents.

Les comparaisons les plus informatives sont présentées dans le tableau 3. La CE50 pour la neutralisation par le donneur, le sérum H récolté 7 jours après la vaccination antigrippale 2011-2012 a été réduit de 1:2,560 sur X179A à 1:480-1:640 sur une sélection de virus du clade 6B isolés de 2013 à 2014. Conformément à cela, le Anticorps monoclonaux spécifiques de la tête dérivés des 4 V les plus abondantsH-ensembles liés (VH 3-7, 3-33, 1-18 et 3-15), représentant 138 des 157 (88 %) des séquences de clones du donneur H, ont perdu la capacité de neutraliser les virus du clade 6B (tableau 3). HA K163Q est l'une des substitutions qui définit le clade 6B, mais il est absent dans A/California/07/2009 (WHO Influenza Center September 2014 report ref. 30).

En revanche, les antisérums de furets infectés par A/California/07/2009 sont connus pour se concentrer sur le site Sa autour des positions 153-155, qui est conservé dans les virus du clade 6B (32). L'anticorps de contrôle d'un donneur différent, 2-12C, mappé aux positions 130 et 155, comme les antisérums de furet, a conservé la capacité de neutraliser les virus du clade 6B à <10 ng/ml, similaire à son activité sur A/California/07 /2009 (tableau 3). La séquence d'acides aminés entre 128 et 159 est identique pour A/California/07/2009 et les virus du clade 6B, ce qui est cohérent avec la rétention des sites de liaison pour les antisérums de furet standard et l'anticorps 2-12C. Le contrôle Q11A6 a montré une reconnaissance similaire à 2-12C et a également conservé la neutralisation des virus du clade 6B.

Inhibition croisée par des anticorps anti-H1N1pdm09 HA. Nous avons recherché l'inhibition croisée de la liaison à l'HA purifié par les différents ensembles d'anticorps isolés du donneur H qui sont sensibles à la substitution K163E/Q et les avons comparés à la fois à l'anticorps bloquant les récepteurs 2-12C (VH 5-51*01 reconnaissant K130/G155) isolé d'un donneur différent et d'un V typiqueH Anticorps réactif à la tige 1-69. Nous avons testé 3 ensembles d'anticorps bloquant les récepteurs du donneur H basés sur VH 3-7*01, 1-18*01 et 3-15*01 et ont découvert qu'ils étaient tous capables de s'inhiber mutuellement dans un test ELISA mais n'étaient pas inhibés par le V typiqueH Anticorps réactif à la tige 1-69 (Figure 3 supplémentaire). En revanche, aucun de ces anticorps du donneur H n'a pu entrer en compétition pour la liaison avec l'anticorps 2-12C spécifique de H1N1pdm09 HA, qui a été cartographié à côté du site de liaison au récepteur par les substitutions K130E et G155E. Comme le montre la figure supplémentaire 3, l'anticorps 2-12C pourrait inhiber la liaison du VH 3-15 anticorps, T3-4B. Cette compétition unidirectionnelle suggère un chevauchement dans les empreintes de liaison de ces deux anticorps.

La réponse en anticorps du donneur H est focalisée. Pris ensemble, ces résultats suggèrent qu'environ 88 % des anticorps monoclonaux réactifs à l'HA dérivés des plasmablastes du jour 7 produits par le donneur H en réponse à la vaccination avec H1N1pdm09 HA de A/California/07/2009 étaient concentrés sur une région limitée de la tête HA domaine et partageait une empreinte qui se chevauchait qui incluait la position K163, qui a été substituée dans les virus du clade 6B qui ont évolué depuis 2013 (WHO Influenza Center septembre 2014 rapport réf. 30).

Réactivité avec A/URSS/90/1977. La fréquence élevée des mutations somatiques dans les 4 ensembles d'anticorps monoclonaux du donneur H qui reconnaissent K163 a suggéré qu'ils pouvaient avoir été sélectionnés dans le pool de cellules B mémoire (33). Il est bien connu que la première exposition au virus de la grippe induit un répertoire de cellules B qui restent à vie, parmi lesquelles les expositions ultérieures à la grippe peuvent sélectionner, en cas de réaction croisée (34 – 37). Les virus H1N1 apparentés à A/USSR/90/1977 sont réapparus chez l'homme en 1977 après avoir été absents depuis 1957. Le donneur H étant un enfant en 1977, il est fort probable que la première exposition aux virus H1N1 ait été un virus apparenté à A /URSS/90/1977.

Une sélection d'anticorps monoclonaux du 4 VH-les ensembles apparentés (3-7, 1-18, 3-33 et 3-15), qui dépendaient du résidu K163, ont été testés pour la neutralisation de A/USSR/90/1977. Tous ces anticorps ont fortement neutralisé le virus de 1977, suggérant qu'ils pourraient avoir été amorcés par ce virus (tableau 3). Les résidus d'acides aminés entourant K163, lorsqu'ils sont cartographiés sur la structure HA, forment un patch de surface conservée partagée entre les HA 1977 et 2009, conformément à la réactivité croisée montrée par ces anticorps (Figure 5).

Cartographie du résidu HA1 K163 dans les anciens virus H1N1. Résidu HA1 conservé HA1 K163 (affiché en bleu), qui a été sélectionné pour être substitué par le VH 3-7*01 et 3-15*01, est situé dans un patch (coloré or) de surface conservé parmi A/California/07/2009, A/Brisbane/59/2007, A/USSR/90/1977, et A/South Carolina/1/1918 HA. Les résidus conservés ont été cartographiés avec PYMOL version 1.7 sur PDB:3LZG (15).

Un deuxième donneur avec un schéma de réactivité similaire à celui du donneur H. Pour évaluer la fréquence des individus qui peuvent produire une réponse anticorps hautement focalisée dans la région autour de K163, nous avons comparé les sérums pour la réactivité avec A/California/07/2009 et variante virus portant des substitutions à K163. Sur les 41 échantillons de sérums criblés après vaccination (titre MN >1:40), nous avons trouvé un deuxième exemple dans lequel les sérums ont perdu la capacité de neutraliser les virus H1N1 avec des substitutions K163 (Figure 6). Ces résultats avec les sérums sont cohérents avec ceux de l'enquête de Linderman et al. (14), qui ont trouvé jusqu'à 42% des sérums de donneurs nés avant 1979 ont montré une réactivité réduite avec les isolats du clade 6B H1N1pdm09. Nos deux sérums provenaient de donneurs nés avant 1982 (2 sur 28).

Activités neutralisantes des sérums et anticorps monoclonaux d'individus vaccinés contre les virus variants. (UNE) Sérums d'individus récemment vaccinés nés entre 1943 et 1982 (m = 28) et 1983 et 1988 (m = 13) ont été testés pour la neutralisation des variants X179A et HA portant des substitutions d'acides aminés uniques. Les sérums de deux individus (donneur H et TIV-20) n'ont pas réussi à neutraliser le variant K163E de X179A, et leur réponse s'est concentrée sur le site Sa. Les sérums de deux individus nés entre 1983 et 1988 ont été concentrés sur K130 (site Ca2). La moyenne et l'intervalle de confiance à 95 % sont indiqués. (B) Sérum après vaccination et le VH L'anticorps 3-7 T2-6A du donneur H, ainsi que le sérum après vaccination d'un autre donneur (TIV-20), ont fortement neutralisé X179A mais n'ont pas réussi à neutraliser le variant du virus K163E. Leur activité neutralisante n'a pas été affectée par la substitution K130E. T1-3B et le sérum témoin avaient des titres de neutralisation similaires à tous les virus. Dans nos dosages MN, la DO450 la lecture dépendait de l'expression de NP après l'entrée virale (65). Les dosages de MN ont été effectués en double.

Anticorps largement réactifs contre la tige H1 HA. Tous les anticorps isolés des plasmablastes du jour 7 du donneur H ne dépendaient pas de K163. Nous avons identifié 10 des 157 (6 %) anticorps définis à tige réactive (et 3 séquences supplémentaires étroitement liées) par une combinaison de 4 tests : inhibition de la liaison de l'anticorps C179 à l'HA purifié en ELISA (26, 27), large neutralisation (Figure 2 ), le manque d'activité HAI et le manque de réactivité dans les transferts Western (données non présentées). Six anticorps ont été codés par VH 1-69, 3 par VH 3-23, et 1 par VH 4-39 (Figure 2B et Tableau 2). Ces anticorps nécessitaient une concentration significativement plus élevée (moyenne 366 ng/ml pour le VH 1-69 clones ANOVA, P < 0,001) pour obtenir la neutralisation de X179A par rapport aux anticorps bloquant les récepteurs typiques dans nos tests MN, dans lesquels la lecture était l'expression de la nucléoprotéine (NP) après l'entrée du virus (figure 2B). Le VH 1-69 et VH Les anticorps 3-23 réactifs à la tige ont réussi à neutraliser un virus grippal pseudotypé H5 (EC50

1 g/ml) qui a été enrobé de HA de A/Vietnam/1203/2004 (Figure 2B). Cette proportion d'anticorps réactifs à la tige est cohérente avec le faible niveau de neutralisation de la grippe pseudotypée H5 à 12 jours après la vaccination dans le sérum du donneur H (Figure 1).

Potentiel thérapeutique. Pour déterminer si les représentants des 3 principaux ensembles d'anticorps isolés du donneur H, étudiés en détail ici, étaient protecteurs in vivo, nous avons traité des souris DBA/2 24 heures après l'infection intrapulmonaire avec le virus X179A (qui contenait de l'HA de A/California/07 /2009) avec une dose unique de 10 mg/kg de chaque anticorps. La souche de souris DBA/2 est extrêmement sensible à l'infection grippale (38), et nous avons utilisé un inoculum de virus environ 150 fois supérieur à celui nécessaire pour provoquer une perte de poids de 20% chez au moins 50% des receveurs. Comme le montre la figure supplémentaire 4, les anticorps avec les 3 spécificités principales (tête spécifique VH 3-7, tête croisée VH 3-15, et tige à réaction croisée VH 1-69) ont pu inverser la perte de poids après un délai de 24 à 48 heures. En revanche, les animaux traités avec du PBS ou un anticorps spécifique de H3 HA n'ont pas répondu.

Notre étude a confirmé que la coloration et le tri des cellules B périphériques avec du HA soluble peuvent considérablement enrichir les clones spécifiques du virus HA (19, 23). Cela nous a permis d'analyser un large échantillon d'anticorps monoclonaux provenant d'un seul individu, pour lesquels les chaînes lourdes et légères et la fonction ont pu être attribuées. Cependant, nous reconnaissons que cette méthode peut ne pas échantillonner le répertoire complet des cellules B spécifiques de l'HA. Les plasmablastes qui ont perdu l'expression de l'Ig de surface seraient manqués, et la stratégie PCR utilisée sélectionne les clones exprimant l'IgG. De plus, les plasmablastes prélevés au jour 7 peuvent ne pas échantillonner le répertoire complet de cellules B réactives à l'hémagglutinine présent dans le pool de cellules B mémoire.

L'analyse des séquences des 157 anticorps réactifs à l'HA a clairement montré que la réponse des lymphocytes B chez le donneur H était dominée par relativement peu de VH et V gènes et était concentré autour du résidu K163 (tableau 2 et tableau supplémentaire 1). Il est peu probable que cette sélection ait été un artefact de la procédure de tri avec HA car (a) nous avons établi que notre préparation HA présentait des épitopes de la tête et de la tige à l'Ig liée à la membrane (Figure supplémentaire 1A) (b) en ELISA (données non présentées ), notre préparation de HA était liée par des anticorps spécifiques de H1 HA reconnaissant plusieurs épitopes dans la tête et la tige (les anticorps provenaient de notre propre laboratoire et des laboratoires d'Ahmed, Schrader et Lanzavecchia) (c) la même méthode de production a été utilisée pour obtenir des cristaux de protéines correctement repliées ( 39 ) et (d) l'effet dominant de K163 sur la liaison des anticorps a été observé dans les sérums polyclonaux ainsi que les anticorps monoclonaux sélectionnés (figure 6 et tableau 3), comme prévu à partir de la forte proportion de les anticorps monoclonaux qui ont reconnu ce résidu.

Onze VH des ensembles liés aux gènes, diversifiés par des variations dans les réarrangements J et D, représentaient les 157 séquences d'anticorps uniques isolées. Six des dix VHLes ensembles apparentés ont fourni 96 % des séquences d'anticorps, et la majorité de ces ensembles, bien que polyclonaux, étaient dominés par un seul clone étendu, défini par un modèle unique de réarrangements de gènes dans les chaînes lourdes et légères (tableau 2). Chaque VH L'ensemble était encore diversifié par une mutation somatique étendue, de sorte que chacune des 157 séquences était unique. La fréquence des mutations somatiques dans chaque ensemble est illustrée à la figure 2A. Le niveau élevé de neutralisation et d'accumulation de mutations somatiques indiquait qu'elles pouvaient provenir de cellules B mémoire préexistantes (16, 23, 27, 33, 40).

Le V limitéH l'utilisation des gènes que nous avons trouvée chez le donneur H est similaire en étendue à la réponse détectée à la vaccination par Moody et al. ( 41 ), avec jusqu'à 12 VH-ensembles liés chez un individu, cependant, nos données contrastent avec les données d'Okada et al. ( 42 , 43 ), qui a isolé 221 V uniquesH séquences qui ont réagi avec H3 HA par phage display d'un seul individu, qui, contrairement à notre donneur, a été hyperimmunisé par de multiples expositions et vaccinations. VH l'utilisation des gènes était considérablement plus diversifiée dans leur collection, et des anticorps contre les 5 sites antigéniques dans H3 HA ont été identifiés. De même, la majorité des échantillons de sérum obtenus après infection en 1978, 10 ans après l'introduction des virus H3 chez l'homme, contenaient des anticorps dirigés contre plus d'un site sur l'HA (13). Cependant, parmi les échantillons obtenus dans les 3 ans suivant l'introduction de H3, 1969-1971, 17 % ont reconnu un seul site (13). Cela suggère que les expositions multiples à la grippe peuvent induire une gamme plus large d'anticorps codés par une plus grande sélection de VH gènes que nous avons détectés chez le donneur H, qui avait probablement été exposé à H1N1pdm09 pour la première fois (44).

Sur les 157 clones du donneur H, 138 (88 %) provenaient de 4 VH-des ensembles d'anticorps ciblant la tête globulaire de l'HA qui ont réagi de manière croisée entre A/USSR/90/1977 et le récent virus H1N1pdm09. Au moins 10 anticorps (6%) de 3 VH-les ensembles apparentés étaient spécifiques à la tige HA. De plus, au sein des anticorps spécifiques de la tête HA, un sous-groupe de 18 anticorps codés par VH 3-15 étaient largement réactifs contre les anciens virus saisonniers H1, tandis que les autres n'ont pas reconnu les virus isolés entre 1995 et 2007 au moins. Ces profils et degrés de réactivité croisée entre divers virus A et les anticorps monoclonaux humains générés contre la grippe HA sont comparables. ceux trouvés par d'autres ( 22 , 23 , 25 , 27 , 28 , 45 , 46 ).

La dominance du V spécifique à la tête HAH 3-7*01/JH 6*02 séquences que nous avons trouvées dans le plus grand VH-un ensemble lié a été observé dans d'autres réponses individuelles après une exposition au H1N1pdm09 (28, 29). Par exemple, le VH 3-7/JH 6 anticorps réarrangés avec un groupe différent de 4 segments D (3-16*02, 3-22*01, 6-13*01 et 4-17*01) de ceux de notre donneur (3-16*01, 3 -3*01 dans les cadres de lecture 2 et 3, et 3-3*02) (28). Cependant, tous ces segments D sont étroitement liés et partagent un motif de séquence d'acides aminés, DTY, à la jonction D-J. De plus un anticorps d'un représentant de notre VH 3-7*01 clones ont sélectionné la substitution K163E identique au clone 4K8 isolé par Krause et al. ( 28 ). Ce résultat suggère que les deux ensembles de VH 3-7*01 clones se lient au même site sur le HA. Krause et al. ont également montré que leurs anticorps, bien qu'ils n'aient pas eu de réaction croisée avec les anciens virus H1 saisonniers récents (y compris A/Brisbane/59/2007), reconnaissaient les HA de A/USSR/92/1977 et A/South Carolina/1/1918 ( 28).

De plus, dans une étude de séquençage approfondi de sujets vaccinés contre le H1N1pdm09, Jackson et al. ( 29 ) ont noté que les lignées clonales utilisant VH 3-7/JH 6 étaient surreprésentés, la majorité formant une CDR3 de 18 acides aminés, comme nous l'avons constaté chez notre donneur (tableau 2). Cette combinaison a formé une signature pour la réponse des anticorps à l'hémagglutinine 2009 H1.

Dans un VH dendrogramme de séquence d'acides aminés (Figure supplémentaire 2), le VH 3 à 7 clones définis par leurs réarrangements VDJ uniques ne se séparent pas en branches définies par clone. Krause et al. ( 28 ) et Jackson et al. ( 29 ) discutent ce phénomène en détail et fournissent des preuves de la convergence interclonale et de la divergence intraclonale dans les séquences de leur VH 3-7 ensembles, suggérant que les exigences structurelles pour la liaison au H1N1pdm09 HA avaient été résolues indépendamment dans les clones qui utilisaient VH 3-7*01 par différentes combinaisons de réarrangements VDJ particuliers et de mutations somatiques convergentes (28, 29). Nous sommes arrivés à la même conclusion pour notre lot de 6 VH 3-7 clones.

Les 3 autres grands VH ensembles d'anticorps bloquant les récepteurs et 2 VH des ensembles d'anticorps spécifiques à la tige du donneur H ont également montré des preuves de polyclonalité (tableau 2), soulignant la richesse du répertoire disponible pour la liaison à des épitopes HA particuliers chez un individu. De plus, au sein de chaque clone défini par ses réarrangements VDJ, il y avait une mutation somatique étendue, qui augmentait en général avec l'augmentation de l'étendue de la réactivité croisée (figure 2A). Cela serait cohérent avec des cycles répétés de sélection dans le centre germinatif à chaque exposition à la grippe pour les clones les plus réactifs de manière croisée et devrait contribuer aux phénomènes de « séniorité des antigènes » (47) et à la stabilité des « paysages d'anticorps » ( 44 ) observés dans les enquêtes sérologiques des populations humaines au fil du temps.

Dans le cas du VH 3 à 15, des mutations ponctuelles ont donné lieu à des changements de spécificité fine pour les variants grippaux circulants isolés en 1995 (tableau 3). Par exemple, les clones T2-5D et T1-9B partagent les mêmes réarrangements géniques dans les chaînes H et L mais diffèrent par les mutations somatiques, ce qui est associé à une différence dans leur capacité à neutraliser A/Beijing/262/1995 (tableau 3) . Cette réactivité d'anticorps monoclonaux humains produits naturellement contre l'HA sélectionnés par dérive antigénique naturelle reflète les études classiques sur la spécificité des anticorps clonaux chez des souris BALB/c individuelles, testées pour la liaison de virus variants sélectionnés in vitro, qui ont démontré une utilisation restreinte similaire du gène V avec polyclonalité ( 48) et un rôle clairement défini pour la mutation somatique influençant la spécificité fine pour le site HA Sb (49, 50).

Les deux VH 3-7 et V largement réactifH 3-15 anticorps dirigés contre la tête globulaire ainsi qu'un VH Les clones 1-69 spécifiques de la tige HA étaient thérapeutiques chez les souris DBA/2 à une dose de 10 mg/kg (Figure supplémentaire 4), malgré leurs titres de neutralisation très différents in vitro (Figure 2B), comme on le voit pour les anticorps monoclonaux murins ( 51 ). Ces résultats soulignent que les anticorps que nous avons étudiés sont fonctionnels. Il est à noter que, bien que le VH Les anticorps 3-15 seraient désormais redondants en tant qu'agents thérapeutiques en raison de l'expansion récente des virus du clade 6B, ils auraient été utiles pendant au moins 14 ans (1995-2009), au cours desquels leur épitope neutralisant a été conservé.

Compte tenu de nos preuves de la diversité et de la redondance dans la réponse des anticorps humains aux sites antigéniques individuels sur l'HA, il est surprenant que les 4 récepteurs bloquants VH-les ensembles d'anticorps liés du donneur H, représentant 138 des 157 (88 %) du total des clones sauvés, se concentrent sur une région de chevauchement limitée sur la tête HA, impliquant le résidu K163. Le site reconnu s'est avéré distinct du site occupé par l'anticorps bloquant le récepteur 2-12C d'un autre individu (Figure 4 et Tableau 3) et les antisérums de furet de référence après infection par le virus H1N1pdm09, qui ne détectent pas de changement majeur d'antigénicité dans les virus du clade 6B (WHO Influenza Center September 2014 report ref. 30). Cette conclusion était basée sur la perte de neutralisation des virus du clade 6B récemment évolués (qui contiennent tous des mutations à K163) par les 4 ensembles d'anticorps (tableau 3), la sélection de substitutions au même site (K163) par VH 3-7*01 et VH 3-15*01 clones, perte de reconnaissance des virus variants K163E/Q par les 4 séries (figure 3) et inhibition croisée entre les 4 séries d'anticorps pour la liaison à HA (figure 3 supplémentaire).

La focalisation de la réponse en anticorps polyclonaux chez le donneur H a été confirmée par la perte d'activité neutralisante pour les virus sélectionnés pour la substitution K163E/Q, par rapport à A/California/07/2009, dans les sérums obtenus 12 jours après vaccination (Tableau 3). En outre, un criblage de 41 sérums immuns a révélé un deuxième donneur vacciné dont le sérum était incapable de neutraliser les virus avec les substitutions K163E/Q (Figure 6), et deux des anticorps humains témoins qui réagissent de manière croisée entre les anciens virus saisonniers et H1N1pdm09 décrits précédemment (22), fourni par Li et al., a également reconnu K163 (tableau 3).

Les résultats de notre analyse clonale détaillée prolongent deux études sérologiques récentes de la réponse des anticorps humains au virus H1N1pdm09 (14, 37). Li et al. ont montré que des individus humains nés entre 1983 et 1996 (après donneur H), qui ont été exposés au début de leur vie à d'anciens virus H1 saisonniers qui ont retenu le K130, ont concentré étroitement leur réponse en anticorps sur cette région lors de l'exposition à H1N1pdm09 (37). Ceci est similaire au site défini par notre anticorps, 2-12C, dérivé d'un individu témoin, qui a sélectionné pour la substitution K130E, et nous avons également détecté 2 sérums après vaccination avec une neutralisation réduite des virus porteurs de la substitution K130 (Figure 6A), confirmant les observations de Li et al. Cependant, les mutations de K130 ne sont pas encore apparues sous la forme de nouvelles variantes d'hémagglutinines isolées d'humains infectés (WHO Influenza Center September 2014 report ref. 30).

Linderman et al. a noté qu'une infection grippale sévère survenait avec une fréquence plus élevée chez les individus d'âge moyen au cours de la saison 2013-2014, liée à l'apparition des virus du clade 6B H1N1pdm09 et a montré que, dans la cohorte née entre 1965 et 1979 (qui aurait inclus notre donneur), 42% des échantillons de sérum avaient un titre réduit dans les tests HAI et MN sur des virus avec des substitutions K166E/Q (K163 dans notre numérotation HA) (14). Notre article étend ces résultats en montrant que plusieurs anticorps monoclonaux de ces individus peuvent sélectionner des substitutions sur ce même site, ce qui suggère que la sélection se produit dans la nature. Ce lien entre la réponse anticorps focalisée chez l'homme et la sélection de substitutions dans l'HA à partir de virus grippaux trouvés dans la nature a longtemps été suspecté mais pas directement démontré (4, 5, 8 – 13, 48, 52 – 55).

Le mécanisme par lequel cette focalisation de la réponse en anticorps se produit n'est pas clair à partir de ces données, mais trois possibilités incluent (a) une réponse limitée lors de la première exposition à un nouveau virus (13), (b) la sélection de cellules B à réaction croisée du répertoire disponible induite par une exposition antérieure à des virus grippaux apparentés (15 , 16 , 25 , 34 - 37 , 41 , 44 , 47 , 56 , 57 ), ou (c) la sélection et l'expansion de cellules B produisant des anticorps qui influencent l'antigène traitement et présentation aux cellules T de manière à optimiser l'aide des cellules T, « réciprocité de la tuberculose » (33, 58 – 62). Ces mécanismes ne s'excluent pas mutuellement et pourraient agir ensemble.

La région de la surface H1 HA qui entoure immédiatement les substitutions du résidu K163, qui ont été sélectionnées par le VH 3-7*01 et 3-15*01, est dans une large mesure conservé parmi A/California/07/2009, A/Brisbane/59/2007, A/USSR/90/1977 et A/South Carolina/ 1/1918 (Figure 5 et références 15, 56). Les anticorps clonés à partir de survivants de la pandémie de 1918 sélectionnent également des variantes avec des substitutions d'acides aminés sur ce site (15, 56). Ceci concorde avec la très large réactivité du VH 3-15 anticorps et le schéma de reconnaissance plus restreint par VH 3-7 anticorps qui réagissent de manière croisée avec les HA de 1918, 1977 et 2009 mais pas de 2007 (réf. 28 et cet article). Le donneur H est né entre l'émergence des virus H2 en 1957 et la réapparition de l'ancienne grippe saisonnière H1 en 1977, il est donc possible que l'exposition à A/USSR/90/1977 ait été le stimulus qui a amorcé les cellules B, qui ont réapparu comme la réponse dominante et ciblée au virus H1N1pdm09.

Ensemble, ces résultats suggèrent que les réponses anticorps hautement focalisées produites par certains individus sont une « réponse anamnestique partielle » aux épitopes partagés entre un virus les infectant au début de la vie et le virus de défi actuel, comme l'ont démontré de St. Groth et Webster dans un modèle animal en 1966 (35), tel que conçu à l'origine par Thomas Francis comme « péché antigénique originel » (34) et tel qu'élaboré et affiné dans des enquêtes récentes (44, 47, 57).

Nos preuves suggèrent que la grande majorité des anticorps générés par le donneur H partagent une empreinte qui se chevauche sur le domaine de liaison au récepteur HA qui comprend le résidu K163. Les substitutions sur ce site sont récemment devenues courantes dans les virus du clade 6B H1N1pdm09 collectés en 2013-2014 (WHO Influenza Center September 2014 report ref. 30). Cela implique que des anticorps similaires aux ensembles dominants chez le donneur H peuvent être activement impliqués dans la sélection de variants de virus actuellement en circulation dans des régions de séquence qui étaient auparavant conservées dans les HA H1 (figure 5). En principe, ce processus de sélection de variants de virus par une réponse anticorps focalisée sur des plaques de séquence conservée pourrait se produire de manière séquentielle, tant qu'un pool suffisant d'individus sensibles était disponible dans la population pour développer de nouvelles variantes et les transmettre à d'autres individus avec un antigène différent. les antécédents d'exposition qui ont concentré la réponse des anticorps sur de nouveaux sites. Ce concept pourrait être testé par extension des travaux que nous avons décrits ici. Nos résultats suggèrent que les familles dominantes d'anticorps identifiés par séquençage profond après vaccination (29) peuvent être d'excellents candidats pour fabriquer des anticorps monoclonaux recombinants pour la sélection de variants de la grippe in vitro qui pourraient prédire une future dérive antigénique.

Les variantes du clade 6B sont considérées comme antigéniquement de type A/California/07/2009 par l'OMS. Une similitude antigénique a été attribuée sur la base de la réactivité des HAI avec des panels d'antisérums primaires de furets après infection contre une gamme de virus H1N1pdm09, y compris A/California/07/2009 (WHO Influenza Center février 2015 rapport réf. 30). Des études de mutagenèse ont montré que la réponse du furet HAI à A/California/07/2009 est étroitement concentrée sur les résidus 153-155 dans le site antigénique Sa (32). La substitution unique HA G155E dans A/Bayern/69/2009 définit cela, et, avec K130, G155 aide à former l'épitope reconnu par notre anticorps 2-12C. La séquence d'acides aminés entre 126 et 159, qui incorpore tous ces résidus, est identique dans A/California/07/2009 et les virus du clade 6B ce chevauchement de séquence est compatible avec la préservation de la réponse du furet HAI et MN et les titres MN avec anticorps 2-12C qui ne font pas la distinction entre les deux.

Contrairement aux antisérums de furet, la plus grande partie des réponses en anticorps monoclonaux que nous avons détectées, et 42% des réponses sérologiques des individus nés entre 1965 et 1979 (14), distinguent ces deux ensembles de virus. Ces observations montrent que les humains individuels peuvent concentrer leurs anticorps différemment des furets et que les schémas de parenté antigénique entre les isolats de virus déterminés par les antisérums de furet peuvent ne pas toujours prédire la spécificité des réponses des anticorps humains (14, 37). L'importance de cette distinction réside dans le fait que les virus H1N1 2013-2014, qui n'ont pas été détectés comme dérivé dans l'analyse standard avec des sérums de furets, ont été associés à des infections graves chez des humains d'âge moyen et âgés qui se sont révélés auparavant relativement protégés. (63).

Notre analyse clonale détaillée prolonge l'enquête sérologique de Linderman et al. (14) et l'étude de séquençage profond de Jackson et al. après la vaccination (29) en montrant que les anticorps détectés dans ces études peuvent sélectionner des variants de virus in vitro qui correspondent aux variants naturels dominants du clade 6B apparus depuis 2013. Nos résultats montrent que l'évaluation de la parenté antigénique des virus grippaux en évolution avec des panels de les anticorps monoclonaux renouvelables et humains pourraient être un complément très utile aux antisérums de furet traditionnels et peuvent également être utilisés pour prédire la dérive antigénique. En outre, la production d'anticorps monoclonaux thérapeutiques doit être envisagée dans le cadre de la planification nationale de la grippe pandémique. Ceci est particulièrement pertinent pour la menace H7N9, pour laquelle les isolats de virus avec la substitution NA-R292K présentent une résistance aux inhibiteurs de la neuraminidase mais conservent leur virulence et leur transmissibilité (64).

HA sécrétée du virus de la grippe A/England/195/2009. L'ADNc correspondant aux codons 1 à 520 de l'ectodomaine de HA du virus de la grippe A/England/195/2009 a été amplifié et purifié comme décrit précédemment (39, 65). En bref, la construction incorporée à l'extrémité C-terminale comprenait un site de clivage de la thrombine, une séquence de trimérisation, une région d'étiquette histidine pour la purification des protéines et la séquence de reconnaissance BirA LNDIFEAQKIEW pour la biotinylation spécifique au site. La séquence d'ADNc a été optimisée pour les codons pour l'expression eucaryote dans les cellules 293T. La biotinylation a été réalisée avec l'enzyme BirA d'Avidity.

Coloration et tri des plasmablastes. L'identification des plasmablastes par cytométrie en flux était basée sur les méthodes de Smith et al. ( 20 ) avec des modifications mineures. Une semaine après la vaccination, des cellules mononucléées fraîches du sang périphérique ont été mises en suspension dans un tampon de coloration. Un mélange d'anticorps de surface, dont Pacific Blue anti-CD3 (catalogue BD 558117), FITC anti-CD19 (catalogue BD 555412), Allophycocyanine-H7 anti-CD20 (catalogue BD 641396), PE-Cyanine 7 anti-CD27 (catalogue BD 560609), et PE-cyanine 5 anti-CD38 (catalogue BD 555461), ont été ajoutés à l'aliquote de cellules mononucléées du sang périphérique avec 10 µg/ml d'Eng195 HA biotinylé et incubés pendant 30 minutes sur glace. Après lavage avec un tampon de coloration, les cellules ont été encore incubées avec ExtrAvidin-PE (Sigma-Aldrich) pendant 30 minutes sur de la glace. Les cellules ont été lavées et remises en suspension dans du PBS et passées à travers un tamis cellulaire. Le trieur de cellules MoFlo (DakoCytomation) a été utilisé pour le tri. Après avoir appliqué une porte sur les cellules CD3 - CD20 - CD20 lo CD19 + CD27 hi CD38 hi Biotine +, les plasmablastes uniques ont été triés dans des plaques à 96 puits contenant 10 ul de tampon de capture RT-PCR inhibant la RNase (20).

Génération d'anticorps monoclonaux. L'anticorps monoclonal humain a été produit à partir de cellules B uniques comme décrit précédemment (20). En bref, les cellules B individuelles ont été triées directement dans un tampon RT-PCR et les gènes de la région variable de chaque cellule ont été amplifiés dans une réaction RT-PCR en une étape (Qiagen), en utilisant un cocktail d'amorces spécifiques pour la région leader et antisens. des amorces à la région constante Cγ pour la chaîne lourde et Cκ et Cλ pour la chaîne légère comme décrit précédemment (20). Les produits de RT-PCR ont été amplifiés dans des réactions PCR séparées pour les familles de gènes de chaînes lourdes et légères individuelles en utilisant des amorces nichées pour incorporer des sites de restriction aux extrémités du gène variable comme décrit précédemment (20). Ces gènes variables ont ensuite été clonés dans des vecteurs d'expression pour les chaînes lourdes et légères comme décrit précédemment (20). Les plasmides ont été transfectés dans la lignée cellulaire 293T pour l'expression d'anticorps monoclonaux humains recombinants.

Construction de formes transmembranaires d'anticorps monoclonaux humains. Le domaine transmembranaire de l'IgG1 humaine ( 66 ) (GenBank X52847.1) a été cloné à partir de plasmablastes humains triés entre des sites SmaI et HindIII uniques, avec les oligonucléotides 5' GCCCCCATCCCGGGATGAGCTG et ATGGTCAAGCTTACTAGGCCCCCTGTCCGATCATG. Les ADNc de TMIgG1 pleine longueur codant pour les anticorps que nous avons isolés et caractérisés ont été reconstruits en remplaçant la séquence entre les sites uniques SmaI et HindIII dans le vecteur d'expression IgG1 de Smith et al. (20) (GenBank FJ517647) et transfectées dans des cellules 293T pour une coloration avec des préparations de HA recombinantes marquées. Trois anticorps ont été convertis à la forme TM : un spécifique de la tête de H3 HA saisonnier (N2B10, VH 4-61*01) ainsi qu'un pour la tête (T2-9A, VH 3-7*01) et un pour la potence (T1-3B, VH 1-69*01) des HA H1N1pdm09 et H5.

Immunosorbant enzymatique, immunofluorescence indirecte, titrage du virus, HAI et dosages MN. Les tests ont été effectués en utilisant des procédures standard telles que décrites précédemment (65). Les titres ELISA ou MN ont été exprimés en concentrations efficaces demi-maximales (CE50: point médian entre les contrôles négatifs et positifs du plateau) dérivé par interpolation linéaire à partir des points voisins de la courbe de titrage. Le test MN détecte l'inhibition de l'entrée du virus dans les cellules MDCK-SIAT-1 en l'absence de trypsine (67), avec un anticorps présent tout au long du test (23). Les tests MN avec les virus du clade 6B ont incorporé une étape de réplication en présence de trypsine pendant 48 heures, ce qui a donné une coloration de fond plus faible avec l'anticorps en développement contre NP AA5H (65). Des échantillons de sérum et de plasma ont été inactivés par la chaleur à 56°C sans traitement RDE, et les anticorps monoclonaux n'ont pas été traités. Les échantillons de sérum et de plasma du donneur H prélevés le même jour n'ont pas donné de titres significativement différents dans le test MN. Sept anticorps publiés ont été inclus : 15-2A06, 19-4G05, 05-2G02 et 09-3A01 (22) ainsi que SF70-1F02 (25) étaient des cadeaux de Rafi Ahmed (Emory University, Atlanta, Georgia, USA) V3 -2G6 (23) était un cadeau de John Schrader (Université de la Colombie-Britannique, Vancouver, Colombie-Britannique, Canada) et FI6v3 (24) était un cadeau d'Antonio Lanzavecchia (Institute for Research in Biomedicine, Bellinzona, Suisse). La compétition des anticorps a été évaluée par des ELISA réalisés avec des anticorps marqués à la biotine en présence d'un excès d'anticorps bloquants non marqués. La détection a été réalisée avec de l'ExtrAvidin (Sigma-Aldrich) marquée par HRP.

Études animales. Des souris DBA/2 (DBA/2 OlaHsd) H2d ont été achetées chez Harlan et logées dans des cages ventilées individuellement. Le virus vaccinal X179A (fourni par le National Institute for Biological Standards and Control, South Mimms, Royaume-Uni) avait une dose minimale qui a entraîné une perte de poids d'au moins 20 % chez 50 % des souris (MD50) de 32 culture tissulaire dose infectieuse 50 % (TCID50). Les souris ont été anesthésiées avec de l'isoflurane (Abbot) et ont été infectées par voie intranasale avec 4,6 × 10 3 TCID50 X179A (

150 × DM50), suivie 24 heures plus tard par i.p. transfert de 500 µl d'anticorps à la dose de 10 mg/kg chez des animaux anesthésiés. Les souris ont été pesées et notées selon les critères décrits précédemment (65), et les souris avec une perte de poids de 20 % ou des scores cliniques morbides ont été tuées sans cruauté.

Sélection de variants grippaux avec anticorps monoclonaux. Environ 10 7 TCID50 Le virus X179A a été mélangé avec l'anticorps à 20 ug/ml et incubé à 37°C pendant 1 heure. Le mélange a ensuite été dilué à 10 ml (

2 à 4 g/ml d'anticorps) avec un milieu de croissance viral (DMEM, 0,1% BSA, 10 mM HEPES, pH 7,0, pénicilline et streptomycine) (65), et 100 l ont été ajoutés à 80 puits d'un 96 puits à fond plat plaque de microtitration contenant des monocouches confluentes de cellules MDCK-SIAT-1 (68) plaquées la veille. Les puits restants contenaient du milieu sans virus pour comparaison. Le mélange a été incubé pendant une heure supplémentaire à 37°C, puis 100 ul de milieu de croissance virale ont été ajoutés, contenant de la trypsine à 2 ug/ml. Le mélange a été incubé à 37°C pendant 48 heures, puis le milieu de chaque puits a été retiré et stocké. Les monocouches ont été colorées pour l'expression de NP comme décrit précédemment (65), et les virus des puits montrant une réplication en présence d'anticorps ont été clonés par dilution limite en présence d'anticorps à une concentration finale de 1 g/ml (ou une concentration saturante connue ). Les virus de clones uniques ont été multipliés dans des cultures de 3 ml pour l'extraction de l'ARN, l'amplification par PCR de la HA et de la neuraminidase et le séquençage des produits de PCR.

Numérotation des séquences de l'hémagglutinine. La numérotation des séquences tout au long du manuscrit fait référence au polypeptide H1 HA mature, c'est-à-dire avec la séquence signal supprimée, tel qu'il est utilisé dans les rapports annuels et intermédiaires du Centre collaborateur de l'OMS pour la référence et la recherche sur la grippe, le Crick Worldwide Influenza Centre, et les résumés des Réunions de l'OMS sur la composition des vaccins ( 1 , 30 ).

Statistiques. Les graphiques ont été générés à l'aide du logiciel GraphPad Prism (version 5) et de Microsoft Excel 2010. L'analyse statistique a été effectuée par GraphPad Prism et SPSS. P des valeurs inférieures à 0,05 ont été considérées comme significatives.

Approbation de l'étude. Cette étude a été réalisée conformément à la Déclaration d'Helsinki et aux directives de bonnes pratiques cliniques. Les protocoles et le consentement éclairé ont été examinés et approuvés par le Comité d'éthique de la recherche tropicale d'Oxford et le Weatherall Institute of Molecular Medicine. Le consentement éclairé signé a été obtenu de chaque donneur individuel qui a fourni un échantillon de sang. Toutes les procédures animales ont été approuvées par un comité d'éthique interne de l'Université d'Oxford et le ministère de l'Intérieur du Royaume-Uni.

Nous remercions les laboratoires Ahmed, Lanzavecchia et Schrader d'avoir fourni les anticorps de référence 15-2A06, 19-4G05, 05-2G02 et 09-3A01 (22) ainsi que SF70-1F02 (25) FI6v3 (24) et V3 -2G6 (23), respectivement, pour les comparaisons dans les tableaux et figures. Nous remercions également Simon Davis, Davide Corti et Antonio Lanzavecchia pour leurs commentaires utiles sur le manuscrit. Ces études ont été financées par le Townsend-Jeantet Charitable Trust (organisme de bienfaisance enregistré n° 1011770), l'Unité d'immunologie humaine (MRC), l'Université d'Oxford, la subvention du programme de recherche médicale Chang Gung (CMRPG4B0041-3) et la subvention du ministère de la Science et de la Technologie de Taïwan. (MOST 104-2320-B-182A-002-MY2). J.W. McCauley et R.S. Daniels sont soutenus par le programme MRC no. U117512723.

Conflit d'intérêt: Les auteurs ont déclaré qu'il n'existe aucun conflit d'intérêts.

Informations de référence: J Clin Invest. 2015125(7) : 2631–2645. doi:10.1172/JCI81104.


Matériaux et méthodes

Déduire l'impact phénotypique des changements d'acides aminés dans l'évolution des protéines

Notre idée est d'adapter la technique d'optimisation des moindres carrés (LSO) de Cavalli-Sforza et Edwards [44] pour l'inférence phylogénétique au problème d'identification de l'impact phénotypique des changements d'acides aminés dans l'évolution des protéines. La méthode originale de Cavalli-Sforza et Edwards [44] identifie des poids de branches représentant les distances génétiques selon le critère des moindres carrés pour une topologie arborescente. Nous avons appliqué cette technique pour déduire des arbres antigéniques, représentant l'évolution antigénique de la principale protéine de surface du virus de la grippe humaine A (H3N2) sur une période de 35 ans. Dans notre adaptation, les longueurs des branches représentent les distances antigéniques déduites des données d'essai HI pour les virus de la grippe humaine A et un arbre de probabilité maximale du domaine HA1 de l'hémagglutinine. La reconstruction des changements d'acides aminés associés aux branches de l'arbre nous permet de déduire l'impact antigénique des changements d'acides aminés associés aux branches. Si des données suffisantes sont disponibles pour résoudre les changements individuels dans les branches individuelles, notre méthode renvoie une estimation de l'impact antigénique des échanges individuels.

En LSO, on minimise la somme des carrés entre les distances données et les distances prévues ré:

W est la matrice de poids pour les différents termes d'erreur, qui ont été mis à un ici. Les distances prévues je, j sont la somme des poids des branches sur le chemin entre les feuilles je et feuille j. Ici, , où Xje,j,k est égal à un si branche k est sur le chemin entre les feuilles je et j dans l'arbre phylogénétique et zéro autrement. Ainsi, nous recherchons le meilleur réglage pour les poids des branches vk. Alors que les distances évolutives sont généralement utilisées dans cette approche, ici, nous cartographions les distances antigéniques pour représenter les poids spécifiques à la branche. Pour restreindre les poids de branche à des valeurs positives, nous avons utilisé l'algorithme de Lawson–Hanson pour un LSO non négatif [45]. Parce que les distances antigéniques ici sont asymétriques (c'est-à-dire je, j j, je) et parce que l'antigène et l'antisérum dirigés contre la même souche virale n'ont pas nécessairement la même position dans l'espace antigénique [13], nous introduisons le concept d'arbres ascendants et descendants. Dans les arbres up𠄽own, les souches virales sont mappées sur les feuilles représentant l'antigène correspondant ainsi que l'antisérum, et chaque branche se voit attribuer deux poids indépendants, le poids supérieur et le poids inférieur. Chaque chemin entre deux taxons je et j dans l'arbre peut être séparé en l'ensemble des branches du taxon je à l'ancêtre le moins commun (ACV) de je et j, et les branches du taxon j à la LCA. Maintenant, le chemin entre l'antigène je et antisérum j implique uniquement les up-weights sur les branches du taxon je à l'ACV et uniquement les sous-pondérations sur les branches du taxon j à l'ACV ( Figure 2 ).

Pour les deux taxons t2 et t4, aucun antisérum n'est présent, et donc, b3 et b6 n'ont que des surpoids. Un chemin de t1 à t3 utiliserait les up-weights de la branche b1 et b2, et les sous-poids de la branche b4 et B5. De même, le chemin de t2 à t1 utiliserait le poids de la branche b3 et le poids de la branche b2. Notamment, le chemin de t1 à t1, à savoir la distance antigénique de l'antigène t1 à l'antisérum élevé contre la souche t1, utiliserait le poids supérieur et le poids inférieur de la branche b1.

Mesures de performance

Pour évaluer la précision avec laquelle les distances antigéniques ont été ajustées sur l'arbre, nous avons utilisé quatre mesures de performance dans des expériences de validation croisée sans exclusion : erreur absolue moyenne (MAE), erreur quadratique moyenne (RMSE), écart type (SD) et corrélation de Pearson coefficient (CC). Dans la validation croisée d'exclusion, un arbre antigénique est déduit de toutes les distances antigéniques sauf une, puis est appliqué pour prédire la distance d'exclusion. Une distance prédite correspond à la longueur du chemin antigénique entre les deux isolats respectifs dans l'arbre (voir ci-dessus). Ceci a été répété pour chaque distance antigénique. Étant donné m distances observées je, j et les distances prévues je, j les mesures de performance sont définies comme suit :

Augmentation et diminution des poids dans l'arbre

Les longueurs des branches antigéniques sont réalisées sous forme de deux poids indépendants, permettant une analyse détaillée de la structure sous-jacente des données antigéniques. Les poids supérieurs représentent la distance antigénique entre les isolats situés en dessous de cette branche et tous les autres isolats en dehors de ce sous-arbre, tandis que les poids inférieurs représentent les distances entre les isolats situés en dehors du sous-arbre et les isolats situés en dessous de cette branche. Ainsi, les types de poids de branche révèlent différentes propriétés du sous-arbre. Laisser e être la branche ascendante de l'ancêtre le moins commun d'un groupe de virus antigéniquement homogène (un type) dans l'arbre. Le surpoids de e définit le degré auquel le type antigénique est séparé des autres types antigéniques selon les antisérums dans d'autres parties de l'arbre, c'est-à-dire dans quelle mesure les antigènes de ce type sont neutralisés par les antisérums dirigés contre d'autres types. Le poids réduit de e définit le degré auquel le type antigénique est séparé des autres types basés sur des antisérums dans cette partie de l'arbre, c'est-à-dire dans quelle mesure les autres types antigéniques sont neutralisés par les antisérums de ce type. Les poids antigéniques de deux types diffèrent souvent, ce qui n'est pas surprenant, car les distances antigéniques ne sont pas symétriques. Pour les branches de pointe, les deux poids définissent le comportement différent de l'antisérum et de l'antigène d'une souche virale. Le poids supérieur reflète les propriétés antigéniques de l'isolat, tandis que le poids inférieur reflète le poids antigénique de l'antisérum dirigé contre l'isolat viral.

Dans le cas où aucun antisérum n'est présent dans un sous-arbre, les pondérations descendantes ne sont pas définies et l'affectation des pondérations montantes devient ambiguë car elles forment des combinaisons linéaires. Pour résoudre ce problème, l'optimisation est effectuée uniquement sur les up-weights conduisant à des feuilles dans le sous-arbre correspondant. Ensuite, les up-weights des branches internes sont fixés au minimum des up-weights sur les branches menant aux nœuds enfants respectifs (ces up-weights sont en conséquence réduits par le minimum) dans un parcours ascendant. La raison derrière cela est que si aucune information supplémentaire n'est présente, les poids antigéniques devraient plutôt être une caractéristique commune d'un sous-groupe de taxons plutôt que la variation d'un seul isolat pour chaque taxon du sous-groupe.

Inférence phylogénétique

Séquences d'hémagglutinine (HA) de 258 isolats du virus de la grippe humaine saisonnière A (H3N2) de 1968 à 2003 et qui ont été utilisées par Smith et al. (2004) [5] ont été téléchargés depuis Influenza Virus Resource (IVR) [46] (Tableau S1).Des alignements de séquences d'ADN et de protéines, limités aux positions 1 à 363 (sites sans données manquantes apparaissant dans plus de 80 00025 des séquences), ont été créés avec Muscle [47] et organisés manuellement. Les arbres ont été inférés avec PhyML v3.0 [48] sous l'inversion générale du temps GTR+I+Γ4 modèle, avec la fréquence de chaque type de substitution, la proportion de sites invariants (I) et la distribution gamma de la variation de taux entre les sites, avec quatre catégories de taux (Γ4), estimé à partir des données. Par la suite, la topologie de l'arbre et la longueur des branches de l'arbre à maximum de vraisemblance déduit avec PhyML ont été optimisés pour 200 000 générations avec Garli v0.96b8 [49]. L'isolat A/duck/33/1980 a été utilisé comme groupe externe pour enraciner l'arbre et a ensuite été retiré de l'analyse ultérieure.

Pour le placement des changements d'acides aminés sur les branches de l'arbre, les séquences protéiques du domaine HA1 de HA (à l'exclusion des sites supplémentaires utilisés pour une résolution plus élevée de l'arbre au cours de l'étape d'inférence de l'arbre) ont été attribuées aux feuilles de l'arbre déduites des séquences nucléotidiques . Les états des caractères ancestraux ont été reconstruits sous le critère du maximum de vraisemblance en utilisant PAML v4.5 [50] sous le JTT+Γ4Modèle ʿ [51], avec la fréquence de chaque acide aminé et la distribution gamma de la variation de taux entre les sites, avec quatre catégories de taux (Γ4), estimé à partir des données. Sur la base des séquences ancestrales reconstruites pour les nœuds internes et les séquences de nœuds foliaires, les changements d'acides aminés ont été attribués aux branches d'arbre individuelles.

Données antigéniques

Données de dosage HI de Smith et al. (2004) a été utilisé et normalisé selon les méthodes de ces chercheurs [5]. Pour chaque antigène je, antisérum j et le titre HI correspondant hje, j, la distance a été définie comme je, j = log2(max(hj)/hje, j), où max(hj) est l'entrée maximale pour l'antisérum j. L'ensemble de données comprend 4 215 valeurs mesurées entre 273 antigènes et 79 sérums de référence. Comme toutes les souches n'étaient pas disponibles dans l'IVR, 18 antigènes et 9 sérums de référence n'ont pas pu être mappés sur une séquence génétique et ont été exclus de l'analyse. De plus, les valeurs seuils (par exemple 㰐, indiquant la limite inférieure dans le dosage HI en dessous de laquelle les dilutions ne sont pas mesurées) ont été exclues de l'analyse, car ces valeurs ne définissent que des relations à longue distance et nous ne voulions pas introduire un biais potentiel en définissant ces entrées sur des valeurs fixes. Dans le cas de plusieurs antisérums dirigés contre la même souche virale, les valeurs médianes des distances ont été utilisées.

Définition des types antigéniques

Les types antigéniques dans l'arbre antigénique peuvent être distingués en sélectionnant des branches définissant le type en fonction d'une distance seuil. Le seuil a été fixé à 1,0 unité antigénique pour les poids moyens (moyenne des poids supérieurs et inférieurs), de sorte que toutes les branches sont sélectionnées dont les poids moyens sont au moins deux fois plus élevés que les poids moyens de toutes les branches internes. Pour exclure les groupes sous-échantillonnés, toutes les branches menant à des sous-arbres avec trois isolats ou moins ont été exclues.


Résultats

Figure ​ Figure1 1 montre la vue d'ensemble de notre méthode pour prédire les variantes antigéniques du virus de la grippe humaine A/H3N2 en identifiant les positions critiques antigéniques, les règles et leur co-évolution sur l'HA.

Présentation de notre méthode de prédiction des variants antigéniques des virus grippaux humains A/H3N2.

Base de données

Nous avons collecté un ensemble de données d'essai HI, qui contient 181 paires de séquences HA avec 45 séquences HA (virus H3N2) avec 329 acides aminés de 1971 à 2002, à partir de travaux connexes [5]. Selon cet ensemble de données, nous avons appliqué l'arbre de décision C4.5 [8] pour prédire les variants antigéniques en identifiant les positions critiques antigéniques ainsi qu'en découvrant les règles et les positions co-mutées. Dans cet ensemble de données, les principaux échantillons (65%, 122 paires parmi 181 paires) sont constitués de paires de souches vaccinales circulantes, et pour chaque paire on savait s'il y avait inhibition de la souche circulante par des anticorps contre la souche vaccinale (" variantes antigéniques" et "virus similaires"). Les souches vaccinales sont sélectionnées par l'Organisation mondiale de la santé (OMS) et sont souvent les souches dominantes des saisons grippales. Chaque paire comprend la valeur du test HI (c'est-à-dire la distance antigénique) et une chaîne de bits avec 329 bits binaires en alignant une paire de séquences HA (329 acides aminés). Pour une position spécifique sur une paire de séquences HA, la valeur binaire est "1 (nommé comme mutation)" si les types de résidus des deux séquences sur cette position sont différents inversement, sa valeur binaire est "0 (nommé comme pas de mutation) ". En général, un vaccin antigrippal doit être mis à jour si une valeur d'essai HI est supérieure à 4,0 entre la souche vaccinale actuelle et les souches attendues pour la saison prochaine [6]. La distance antigénique est définie comme l'inverse de la moyenne géométrique de deux rapports entre les titres d'anticorps hétérologues et homologues [5]. Parmi 181 paires de séquences HA, 125 paires avec une distance antigénique ≥ 4 sont considérées comme des « variants antigéniques » et 56 paires avec une distance antigénique < 4 sont classées comme des « virus similaires ». Par exemple, la distance antigénique du couple de séquences HA, A/Port_Chalmers/1/73 et A/Victoria/3/75, est de 16 et ce couple est considéré comme des « variants antigéniques ». A l'inverse, la distance antigénique du couple de séquences HA, A/Wuhan/359/95 et A/Nanchang/933/95, est de 1 et ce couple est considéré comme des « virus similaires ».

De plus, nous avons préparé un autre ensemble de données d'essai HI proposé par Smith et al. [6] pour évaluer indépendamment notre modèle et le comparer avec d'autres méthodes de prédiction des variants antigéniques. Cet ensemble de données se compose de 253 virus H3N2, qui sont regroupés en 11 groupes antigéniques. Nous supposons qu'une paire de virus dans le même groupe antigénique est considérée comme une paire de "virus similaires" et une paire de virus dans des groupes différents est considérée comme une paire de "variants antigéniques". Enfin, nous avons fourni 31 878 mesures d'HI et ces séquences ont été extraites des supports de publication [6].

Positions critiques antigéniques sur HA

Dans cette étude, nous avons utilisé le gain d'information (IG) et l'entropie de Shannon pour mesurer les scores d'un acide aminé, qui se localise à la position spécifique sur HA, pour discriminer les variants antigéniques et les virus similaires (voir Méthodes). Les valeurs les plus élevées et les plus basses de l'IG et de l'entropie sont respectivement 1 et 0. Un acide aminé avec une IG élevée à une position spécifique impliquait que cette position est fortement corrélée aux variants antigéniques. Un acide aminé avec une entropie élevée signifie que cette position est souvent mutée dans l'ensemble de données. Figure ​ Figure2 2 montre la relation entre les valeurs IG et les entropies des positions HA. Les résumés de certaines positions d'acides aminés sont répertoriés dans le tableau ​ Tableau1. 1 . Sur les 329 acides aminés de HA, 131 positions sont considérées comme se trouvant dans ou à proximité des cinq sites de combinaison d'anticorps (appelés épitopes) qui sont marqués de A à E [9]. Le premier rang (c'est-à-dire la position 145-A) se situe au niveau de l'épitope A de HA. Son IG et son entropie sont respectivement de 1,0 et 0,87. Parmi 181 paires de séquences HA dans l'ensemble d'apprentissage, la position 145-A mute sur 62 paires et 61 paires sont les variants antigéniques. Ce résultat implique qu'une mutation sur cette position induit fortement une dérive antigénique. Cette observation est cohérente avec les résultats précédents [6], c'est-à-dire que la substitution d'un seul acide aminé N145K peut être responsable de la transition de cluster antigénique. Nous avons observé que les autres positions avec des valeurs élevées d'IG ont obtenu des comportements similaires.

La relation entre les entropies et les gains d'information de 329 acides aminés sur la protéine HA. Les positions dans la zone I (par exemple 145-A, 189-B et 278-C) avec à la fois une entropie élevée et des valeurs d'IG élevées sont fortement corrélées aux variants antigéniques. 145-A désigne la position d'acide aminé 145 située à l'épitope A.

Tableau 1

L'entropie, le gain d'information et les positions co-mutées de 15 positions d'acides aminés sur les séquences HA

Position-épitopeEntropieIGNombre de positions de comutationPositions co-mutéesSélection positiveTransition de cluster
145-A 1 0.871.00129,31,63,78,83,126,137,160,193,197,242,278+ 2 + 3
137-A0.680.41239,31,53,54,62,63,83,126,143,145,146,158,160,164,174,189,193,201,213,217,244,260,278 +
193-B0.860.23179,31,63,78,83,126,137,145,158,160,164,174,201,217,242,260,278++
160-B0.580.28162,31,54,62,126,137,143,146,156,158,164,197,217,244,260,278 +
156-B0.800.43854,62,143,146,160,197,244,260++
226-D1.000.152145,189+
135-A0.830.071165+
121-D0.720.000 +
142-A0.470.000 +
186-B0.410.000 +
164-B0.240.466126,137,158,174,201,217, +
201-D0.270.364137,164,174,217 +
78-E0.140.29431,63,126,242
174-D0.320.474137,164,201,217 +
63-E0.190.39678,83,126,137,242,278

1 L'épitope de la position sur la séquence HA.

2 le poste est sous sélection positive définie par Bush et al. [3].

3 la position est une substitution de différence de cluster définie par Smith et al. [6].

La relation entre les valeurs IG et les entropies de 101 positions dans HA est illustrée à la figure ​ Figure2 2 en excluant 228 positions, qui ont zéro pour IG et entropie. Toutes les positions peuvent être classées en quatre groupes selon les valeurs d'IG (degré antigénique) et d'entropie (c'est-à-dire la diversité génétique). Ces 19 positions avec un IG élevé et une entropie élevée (c'est-à-dire la zone I) sont considérées comme des positions critiques dans ce travail. Selon la structure HA obtenue à partir de la banque de données de protéines (code PDB 1HGF [10]), 18 positions d'entre elles se localisent sur cinq épitopes et 15 d'entre elles sont à la surface (Figure ​ (Figure 3) 3) en utilisant PyMOL [11 ]. Les positions dans la zone II (c'est-à-dire une entropie élevée et un faible degré antigénique) impliquent qu'une diversité génétique élevée peut inférer un faible score de discrimination antigénique. Par exemple, les positions (par exemple 226-D, 135-A, 121-D, 142-A et 186-B) ont des entropies élevées et des valeurs d'IG faibles (tableau ​ (tableau1 1 et figure ​ figure2). 2 ). Parmi 181 paires de séquences HA, la position 226-D mute sur 61 paires et 34 de ces paires sont le variant antigénique. Une position faible de l'IG indique qu'une mutation sur cette position a moins de préférence pour être un variant antigénique. Notre méthode permet d'éviter l'inconvénient de ne considérer que les données génétiques, largement utilisées dans les travaux antérieurs.

La distribution des valeurs IG et des scores de co-mutation sur la structure HA. (A) La distribution des valeurs IG de 329 acides aminés sur la structure HA (PDB code 1HGF) et le R indique le site de liaison au récepteur. Le bleu et le gris indiquent respectivement la valeur IG la plus élevée et la valeur IG la plus basse. (B) Les emplacements structurels et les scores de 12 positions de co-mutation de la position 145. Ces structures sont présentées en utilisant PyMOL.

La relation entre les valeurs IG et les emplacements structurels de 329 positions est illustrée dans la figure ​ Figure 3A. 3A. Les positions avec les quatre valeurs IG les plus élevées (c'est-à-dire 145-A, 189-B, 278-C et 158-B) sont bleues et les autres positions sont proches du gris sur la base des valeurs IG. Les positions avec des valeurs élevées d'IG sont situées à la surface de la protéine. Trois (145-A 189-B et 158-B) des quatre premières positions de valeur IG sont situées autour du site de liaison au récepteur, qui est essentiel pour neutraliser le virus de la grippe. De plus, les positions IG élevées préfèrent également se localiser sur la tête supérieure, qui sont plus exposées et de préférence reconnues par les anticorps, de HA et sur l'interface entre les monomères HA.

Les règles des variants antigéniques et les précisions de prédiction

Nous avons utilisé l'arbre de décision (Figure ​ (Figure 4) 4 ) pour construire un modèle de prédiction des variantes antigéniques du virus de la grippe humaine A/H3N2. Sur la base des valeurs IG de 329 positions d'acides aminés dérivées de 181 paires dans l'ensemble de données d'apprentissage, six positions d'acides aminés sont sélectionnées comme nœuds internes dans cet arbre. La première règle de cet arbre est que le type antigénique est prédit comme variant antigénique si la position 145 est mutée, c'est-à-dire que les types de résidus d'une paire de séquences sur la position 145 sont différents. Parmi 181 paires de séquences dans l'ensemble d'apprentissage, 62 paires peuvent appliquer cette règle et 61 paires peuvent être prédites correctement. La dernière règle de cet arbre est que le type antigénique est prédit comme les virus similaires si six positions (c'est-à-dire 145, 189, 62, 155, 213 et 214) ne sont pas mutées.

L'arbre de décision et les règles de prédiction des variants antigéniques. Chaque nœud interne (cercle) est représenté par une position d'acide aminé. Le nœud feuille (carré) comprend le type antigénique prédit (c. .

Sur la base de ce modèle, nous pouvons dériver sept règles et les précisions prédites sont respectivement de 91,2 % (165/181) pour l'ensemble de données d'apprentissage et de 96,2 % (30 675/31 878) pour l'ensemble de données indépendant. Comme le montrent la Figure ​ Figure5 5 et le Tableau ​ Tableau2, 2 , notre méthode a surpassé deux méthodes comparatives, à savoir Wilson & Cox (89,7 %) [9] et Lee & Chen (92,4 %) [5 ], sur l'ensemble de données indépendant. Pour l'ensemble de données indépendant, les précisions de la méthode Wilson & Cox sur la prédiction des variants antigéniques et des virus similaires sont de 99,71 % et 32,74 %, respectivement. À l'inverse, notre modèle a bien fonctionné pour prédire les variants antigéniques (99,73 %) et les virus similaires (76,34 %).

Comparez notre méthode avec les deux autres méthodes de prédiction des variants antigéniques sur deux ensembles de données.

Tableau 2

Comparer notre méthode avec d'autres méthodes de prédiction des variants antigéniques sur 31 878 paires

Variantes antigéniquesWilson & Cox, 1990 [9]Lee & Chen, 2004 [5]Notre méthodeVirus similairesWilson & Cox, 1990 [9]Lee & Chen, 2004 [5]Notre méthode
HK68-EN72 (210 1 )210206210HK68 (91 1 )245237
EN72-VI75 (135)135135135EN72 (105)367948
VI75-TX77 (27)272727VI75 (36)303621
TX77-BA79 (48)484845TX77 (3)121
BA79-SI87 (400)400381400BA79 (120)134658
SI87-BE89 (1600)15778631600SI87 (300)125233276
BE89-BE92 (3648)364836483648BE89 (2016)87217252016
BE92-WU95 (1596)154213911562BE92 (1596)372928732
WU95-SY97 (448)448448448WU95 (378)53156325
SY97-FU02 (96)969696SY97 (120)2465120
Autres inter clusters (18890)188891887018855FU02 (15)151515
Nombre de paires prédites270202611327026Nombre de paires prédites156533373649
Précision99.71%96.37%99.73%Précision32.74%69.81%76.34%

1 le nombre de paires dans le cluster.

Positions co-mutées pour les variants antigéniques

Deux positions d'acides aminés peuvent muter simultanément pour provoquer une dérive antigénique ou une forte co-évolution dans le virus H3N2. Comprendre la co-mutation des paires de positions d'acides aminés est l'une des étapes clés pour reconnaître les interactions antigène-anticorps. Ici, nous avons utilisé le score de co-mutation, S(je, j) (voir Méthodes), entre la position je et sa position co-mutée j pour mesurer la paire co-mutée (je, j) pour prédire les variants antigéniques. Nous avons calculé toutes les combinaisons co-mutées (c'est-à-dire 10 100 paires) de 101 positions d'acides aminés qui ont muté plus d'une fois sur 181 paires de séquences HA dans l'ensemble de données d'apprentissage.

Tableau ​ Tableau1 1 montre les positions co-mutées de certaines positions HA. Dans ce travail, le poste (j) est considérée comme la position de co-mutation de la position (je) lorsque son z-score de co-mutation (c'est-à-dire Z(je, j) défini comme l'équation (7) dans les méthodes) est supérieur à 2,3 parce que le score du poste je et j est significatif (la valeur p est de 0,01) dérivée de 10 100 paires. Parmi 329 positions de séquences HA, 40 positions ont des positions co-mutées. Le nombre de positions co-mutées pour une position varie de 0 à 23 et le nombre total de paires significatives est de 308 parmi 10 100 paires.

Dans le modèle arborescent (Figure ​ (Figure4), 4 ), la position 145-A est sélectionnée comme premier nœud et a 12 positions co-mutées significatives (Table ​ (Table1 1 et Figure ​ Figure3B). 3B). Les trois premières positions comutées significatives de 145-A sont (145-A, 126-A), (145-A, 278-C) et (145-A, 137-A). Les 145-A, 278-C et 137-A sont les résidus qui provoquent la transition du cluster EN72 vers le cluster VI75 [6]. De plus, le résidu 156-B a 8 positions co-mutées significatives (tableau ​ (tableau 1). 1). Sept (à l'exception de la position 260-E) de ces 8 positions co-mutent avec 156-B pour provoquer la transition de l'amas TX77 vers l'amas BK79 [6].

Tableau ​ Tableau 3 3 montre le nombre de positions de co-mutation significatives sur six blocs, y compris cinq épitopes et l'autre zone sur la protéine HA. Les nombres (24 et 19 paires, respectivement) des paires de co-mutation, qui se trouvent aux épitopes A et B, sont significativement plus élevés que les autres blocs. Ce résultat implique que la mutation sur les épitopes A et B pourrait donner une forte probabilité de provoquer la dérive antigénique. De plus, les résidus dans les épitopes A et B forment 82 et 71, respectivement, des paires de co-mutations significatives qui sont beaucoup plus élevées que les autres blocs. D'autre part, le nombre (c'est-à-dire 18 paires) de paires de co-mutation significatives formées par les résidus dans le bloc non épitopique est le plus petit parmi les 36 combinaisons de six blocs (tableau ​ (tableau 3). 3). Ces résultats démontrent que les épitopes A et B sont plus importants que les autres blocs et que les cinq épitopes sont plus importants que l'autre zone. Des travaux antérieurs montrent que les épitopes A et B sont plus importants sur le plan antigénique car ils se trouvent autour du site de liaison au récepteur [9].

Tableau 3

Le nombre de positions de co-mutation de cinq épitopes et l'autre zone sur la protéine HA

Epitope AÉpitope BÉpitope CÉpitope DEpitope EAutre zonesomme
Epitope A152481116882
Épitope B191561313571
Épitope C1511359447
Épitope D1213386446
Epitope E1311467344
Autre zone42134418

Figure ​ Figure 6 6 montre les distributions des scores z de co-mutation de six positions HA. Les positions (c'est-à-dire 145-A et 137-A situées dans la zone I de la figure ​ Figure2) 2 ) qui ont des valeurs IG élevées et des entropies élevées, possèdent 12 et 23 positions co-mutées (Figure ​ (Figure 6A 6A et Tableau ​ Tableau1), 1 ), respectivement. D'autre part, la figure ​ Figure6B 6B montre deux positions (c'est-à-dire 226-D et 135-A situées dans la zone II de la figure ​ Figure2), 2 ), qui ont de faibles valeurs d'IG et des entropies élevées, propres 2 et 1 positions co-mutées (Table ​ (Table1), 1 ), respectivement. Enfin, les positions 164-B et 201-D ont des distributions similaires (Figure ​ (Figure6C) 6C) et leur coefficient de corrélation est de 0,73. Considérer à la fois les valeurs d'IG et les entropies donne un aperçu des positions antigéniques du projet et de la co-évolution sur le virus de la grippe. Ces résultats montrent que notre méthode est capable d'identifier des positions co-mutées qui participent à la dérive antigénique pour les saisons grippales. Ces positions co-mutées significatives montrent une signification biologique.

Les distributions de co-mutation z-score de six positions sur la séquence HA. Une position est considérée comme un résidu de co-évolution si son z-score est supérieur à 2,3 (c'est-à-dire la ligne bleue).


Données et méthodes

Cette étude utilise 560 séquences, chacune longue de 987 nucléotides, du gène HA1 de type H3 isolé entre 1968 et 2000 à partir d'emplacements dans le monde entier. Les séquences ont été obtenues à partir d'une base de données publique [réf. 10 Laboratoire national de Los Alamos, base de données sur la séquence de la grippe (http://www.flu.lanl.gov/)]. Nous utilisons les termes génotype et souche de manière interchangeable pour désigner une séquence nucléotidique de HA1. Les virus ont été isolés par des cultures de cellules d'œuf ou de rein (3). Toutes les séquences ont été facilement alignées sans lacunes.

Chacune des 560 séquences est associée à une année civile d'isolement, dans certains cas déduite du nom de la souche.Pour 439 des séquences, cependant, des informations plus détaillées sont disponibles, leur permettant d'être réparties en saisons grippales, définies du 1er octobre au 30 septembre. Par exemple, la « saison 94/5 » fait référence aux séquences collectées entre le 1er octobre 1994 et le 30 septembre 1995.

La plupart des séquences ont été générées dans le cadre du programme de surveillance à long terme de la grippe de l'Organisation mondiale de la santé (OMS). Comme nous le discutons ci-dessous, seule une faible proportion des virus isolés par l'OMS sont également séquencés. Les nouveaux isolats antigéniques sont séquencés de manière préférentielle par l'OMS (11). Par conséquent, la base de données fournit une approximation biaisée des fréquences mondiales des souches.

Méthodes.

Pour identifier des clusters de séquences virales, il faut d'abord attribuer une distance entre les séquences. Nous définissons la distance entre deux séquences HA1 comme la somme des distances par paires entre leurs 329 acides aminés composites. Plusieurs métriques d'acides aminés sont possibles. La métrique la plus simple, appelée métrique de Hamming, vaut zéro ou un selon que deux acides aminés sont identiques. Des métriques alternatives pondèrent les différences entre les acides aminés en fonction de leurs propriétés stéréochimiques [par exemple, la métrique de Miyata (12)], ou de leurs fréquences de substitution dans les familles de protéines (13). Ici, nous présentons des résultats basés sur la métrique de Hamming. Les résultats basés sur la métrique Miyata sont similaires.

Idéalement, la distance entre une paire de séquences devrait refléter les propriétés immunogènes des protéines virales correspondantes. Certaines mesures ont été prises dans ce sens. Par exemple, Lapedes et Farber (14) ont dérivé une mesure de distance pour l'HA à partir d'essais de liaison d'anticorps, tandis que Wilson et Cox (15) ont développé une métrique basée sur les changements de la surface accessible au solvant de la molécule d'HA repliée. Néanmoins, des données de liaison aux anticorps plus détaillées et une meilleure compréhension du repliement de l'HA sont nécessaires avant que ces métriques puissent être appliquées de manière exhaustive dans notre contexte.

En utilisant leurs distances par paires, nous identifions un partitionnement naturel des séquences en groupes disjoints, ou clusters, via un algorithme de clustering à liaison unique (16). Le clustering traditionnel à liaison unique produit une hiérarchie de partitions commençant par chaque séquence dans son propre "cluster" unique et fusionnant successivement les clusters dont les voisins les plus proches sont à une distance minimale les uns des autres, regroupant finalement toutes les séquences en un seul grand cluster. Des hiérarchies de clusters ont été utilisées pour générer des arbres phylogénétiques (17). Dans cet article, cependant, nous ne considérons pas la hiérarchie des clusters, mais inspectons plutôt les clusters eux-mêmes à une distance de liaison convenablement choisie. En ce sens, notre analyse est un complément logique à l'approche phylogénétique.


Conclusion

Les différences dans l'étendue de la variation de l'HA par rapport aux glycoprotéines de liaison aux récepteurs d'autres agents infectieux aigus sont supposées être liées à l'existence, chez les espèces aviaires, d'un réservoir de virus grippaux qui contient les 16 sous-types d'HA. A partir de ce réservoir, à trois reprises au cours du siècle dernier, de nouveaux virus ont été introduits dans la population humaine directement par transfert interspécifique ou suite à un réassortiment génétique entre un virus aviaire et un virus humain existant. À la suite de ces pandémies, la variation antigénique se produit sous pression immunitaire et pourrait probablement se poursuivre jusqu'à ce que la viabilité du virus soit compromise par des effets sur la fonction de liaison au récepteur de la cible HA, ou jusqu'à ce que la variation soit limitée d'une autre manière. Les mutations qui introduisent de nouveaux sites pour la glycosylation, par exemple, peuvent être importantes à cet égard car, contrairement aux sites antigéniques sur lesquels plusieurs substitutions consécutives d'acides aminés peuvent être sélectionnées, les sites qui sont modifiés par glycosylation ne sont pas subséquemment soumis à une pression immunitaire et sont, comparativement, , 'fixe'. Leur accumulation peut éventuellement limiter le taux de variation antigénique.

Les objectifs de la collecte régulière d'informations sur la variation de l'HA sont principalement de caractériser les virus épidémiques comme une aide à la sélection des composants du vaccin et peut-être éventuellement d'établir l'importance antigénique relative de la variation à des sites particuliers. 52 En théorie, de telles informations pourraient permettre de prédire les changements structurels et antigéniques ultérieurs. Ni l'identification de la dominance du site, ni la capacité de prédire le changement, n'a encore été réalisée.

De plus, la relation entre l'antigénicité et l'immunogénicité reste incertaine. Par exemple, notre connaissance des déterminants de l'immunogénicité de l'HA, ou d'autres facteurs qui conduisent à l'induction d'anticorps des différentes gammes de spécificité chez différents membres infectés de la population, est incomplète. Elle est néanmoins indispensable pour comprendre la voie de la dérive antigénique et éventuellement aussi pour tenter de vacciner efficacement toutes les couches de la population.


Voir la vidéo: 10 FOIS OÙ LES DESSINS ANIMÉS ONT PRÉDIT LE FUTUR! (Février 2023).