Informations

Excrétion et déchets métaboliques ?

Excrétion et déchets métaboliques ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Je sais qu'il y a une différence entre les déchets digestifs et métaboliques, mais lequel s'appelle l'excrétion ? Et comment s'appelle l'autre ? Merci!


L'égestion est l'expulsion des aliments non digérés qui se produit généralement par l'anus. Bien que, de manière intéressante ou peut-être simplement dégoûtante, les vers plats doivent utiliser leur bouche s'ils n'ont pas d'anus. Il s'agit de la matière non métabolisée.

L'excrétion est le transfert de toute matière métabolisée dans l'environnement, y compris l'urine ou le dioxyde de carbone.


13) Excrétion chez l'homme

L'excrétion est l'élimination des substances suivantes :

  • matières toxiques
  • déchets du métabolisme
  • substances en excès provenant d'organismes

Les acides aminés en excès sont désaminés dans le foie pour former du glycogène et urée. L'urée est éliminée des tissus par le sang et expulsée par les reins.

  • Foie – Décompose les acides aminés en excès et produit de l'urée.
  • Poumons – Débarrassez-vous du CO2 et de l'H2O lors de l'expiration.
  • Reins – Élimine l'urée et d'autres déchets azotés du sang et expulse l'excès d'eau, les sels. Hormones et médicaments.
  • Peau – Perd de l'eau, du sel, de l'urée mais pas un organe excréteur.

Le foie et son rôle dans la production de protéines :

  • Joue un rôle important dans assimilation (absorbant) les acides aminés.
  • Élimine les acides aminés du plasma sanguin et les transforme en protéines.
  • Les protéines sont de longues chaînes d'acides aminés, reliées entre elles par des liaisons peptidiques.

Désamination: est l'élimination de la partie azotée des acides aminés pour former de l'urée.

  • L'urine est transportée des reins vers le vessie par le uretères.
  • Urètre est le tube qui transporte l'urine hors du corps.
  • Certains des composés produits lors de réactions dans le corps sont potentiellement toxiques si leurs concentrations s'accumulent.
  • Le CO2 se dissout dans les fluides tels que les fluides tissulaires et le plasma sanguin pour former de l'acide carbonique. Cette augmentation de l'acidité peut affecter les actions des enzymes et peut être fatale.
  • L'ammoniac est fabriqué dans le foie lorsque l'excès d'acides aminés est décomposé. Cependant, l'ammoniac est très alcalin et toxique. Il est converti en urée qui est beaucoup moins toxique, ce qui en fait un moyen sûr d'excréter l'excès d'azote.

Structure microscopique des reins :

  • Le tissu rénal se compose de nombreux capillaires et de petits tubes, appelés tubules rénaux, maintenu par du tissu conjonctif.
  • Les cortex est la région externe sombre.
  • Les moelle est la zone intérieure la plus claire.
  • Une artère rénale transporte le sang vers le rein et une veine rénale l'évacue.
  • L'uretère transporte l'urine du rein à la vessie.
  • Là où l'uretère rejoint le rein, il y a un espace appelé le bassin.
  • L'artère rénale se divise en un grand nombre d'artérioles et de capillaires, principalement dans le cortex.
  • Chaque artériole mène à une glomérule. Il s'agit d'un capillaire divisé et enroulé à plusieurs reprises, formant un nœud de vaisseaux.
  • Chaque glomérule est presque entièrement entouré d'un organe en forme de coupe appelé un capsule rénale, ce qui conduit à un enroulement tubule rénal.
  • Ce tubule, après une série d'enroulements et de boucles, rejoint un conduit collecteur, qui traverse la moelle pour s'ouvrir dans le bassin.
  • UNE néphron est un glomérule unique avec sa capsule rénale, son tubule rénal et ses capillaires sanguins.
  • La pression artérielle dans un glomérule provoque une fuite d'une partie du plasma sanguin à travers les parois capillaires.
  • Les globules rouges et les protéines plasmatiques sont trop gros pour sortir du capillaire, de sorte que le liquide qui filtre à travers est du plasma sans la protéine.
  • Le fluide est donc principalement constitué d'eau avec des sels dissous, du glucose, de l'urée et de l'acide urique.
  • Le processus par lequel le liquide est filtré hors du corps par le glomérule est appelé ultrafiltration.
  • Le filtrat du glomérule s'accumule dans la capsule rénale et ruisselle dans le tubule rénal.
  • Ce faisant, les capillaires qui entourent le tubule réabsorbent dans le sang ces substances dont le corps a besoin.
  • Tout d'abord, tout le glucose est réabsorbé, avec une grande partie de l'eau.
  • Ensuite, une partie des sels est récupérée pour maintenir la concentration correcte dans le sang.
  • Le processus d'absorption des substances nécessaires à l'organisme est appelé réabsorption sélective.
  • Les molécules qui ne sont pas réabsorbées sélectivement continuent le long du tubule du néphron sous forme d'urine.

La machine de dialyse (rein artificiel) :

La dialyse est un traitement qui filtre et purifie le sang à l'aide d'une machine

  • une concentration de glucose similaire à un niveau normal dans le sang
  • une concentration d'ions similaire à celle trouvée dans le plasma sanguin normal
  • pas d'urée

Comme le liquide de dialyse ne contient pas d'urée, il existe un grand gradient de concentration, ce qui signifie que l'urée se déplace à travers la membrane partiellement perméable, du sang au liquide de dialyse, par diffusion.

Comme le liquide de dialyse contient une concentration de glucose égale à une glycémie normale, cela empêche le mouvement net du glucose à travers la membrane car aucun gradient de concentration n'existe.

Comme le liquide de dialyse contient une concentration en ions similaire à la concentration idéale dans le plasma sanguin, le mouvement des ions à travers la membrane ne se produit qu'en cas de déséquilibre.


RLE DES REINS | Histologie du rein

Introduction

L'excrétion implique la séparation et l'élimination des déchets métaboliques du corps. Divers organes sont impliqués dans ce processus : les poumons, les branchies, la peau, etc. Les reins et leurs canaux sont les principaux organes excréteurs à temps plein et constituent le système excréteur.

En plus de l'élimination des déchets métaboliques, le système excréteur fonctionne dans le maintien d'un bon équilibre hydrique dans le corps : un équilibre d'eau, de sels inorganiques et d'autres substances dans l'environnement interne de l'organisme. Il y a une grande différence dans les problèmes d'équilibre hydrique rencontrés par les vertébrés marins, d'eau douce et terrestres, et il est remarquable que leurs reins se ressemblent autant.

Le rein de tous les vertébrés est constitué de nœuds de vaisseaux sanguins, soit des glomérules, soit des glomères, étroitement associés à des masses de tubules rénaux ( Chiffres 1(une), 1(b), et 2 ). Un seul tubule, avec ses vaisseaux sanguins associés, est un néphron.

Figure 1 . Microphotographies d'une section du rein d'un aiguillat commun (Squalus acanthias). (a) Trois glomérules (singulier, glomérule) à droite sont entourés de masses de tubules rénaux. Des capillaires délicats (non visibles) envahissent le tissu conjonctif lâche entre les tubules. 10 ×. (b) L'un des glomérules de (a) est entouré d'une capsule néphrique (capsule de Bowman). La capsule se compose d'un simple épithélium pavimenteux et ressemble à un ballon qui a été poussé par le glomérule de sorte que chaque capillaire est recouvert par la couche viscérale de la capsule néphrique et l'espace est fermé par la couche pariétale. Des masses de tubules rénaux remplissent le champ restant. Des capillaires occasionnels apparaissent entre les tubules 40 ×.

Figure 2 . Micrographies pour démontrer les boucles capillaires dans les corpuscules rénaux d'un poisson téléostéen d'eau douce (Carassius auratus gibelio) En haut : Photomicrographie d'une coupe montrant le nœud bien développé de capillaires avec de nombreuses boucles et une lumière largement perméable. AA, artériole afférente à cellules juxtaglomérulaires (flèches). Échelle = 10 µm. En bas : Micrographie électronique à balayage de la surface des anses capillaires portant des podocytes globulaires à partir desquels s'étendent les apophyses primaires et secondaires du pied. Échelle = 10 µm.

D'après Elger M et Hentschel H (1981) Le glomérule d'un téléostéen d'eau douce stentohaline, Carassius auratus gibelio, adapté à l'eau salée. Une étude au microscope électronique à balayage et à transmission. Recherche sur les cellules et les tissus 220: 73–85 .


Excrétion et déchets métaboliques ? - La biologie

Audesirk / Audesirk : La vie sur Terre Chapitre 21 : Nutrition, digestion et excrétion

De quels nutriments les animaux ont-ils besoin ?

A. Les nutriments animaux se répartissent en cinq grandes classes : glucides, lipides, protéines, minéraux, vitamines.

1. Ces nutriments fournissent au corps ses besoins de base : a. énergie pour alimenter le métabolisme et les activités cellulaires

b. les éléments constitutifs chimiques, tels que les acides aminés, pour construire des molécules complexes uniques à chaque organisme

c. minéraux et vitamines qui participent à une variété de réactions métaboliques.

1. Les glucides complexes sont la principale source d'énergie absorbée par le corps. Les animaux, y compris les humains, stockent un glucide appelé glycogène (une chaîne hautement ramifiée de molécules de glucose) dans le foie et les muscles. Celui-ci est ensuite dégradé en glucose, la principale source d'énergie disponible pour les cellules individuelles.

2. Les sucres simples ne contiennent pas de fibres, de vitamines et de minéraux.

1. Les phospholipides et le cholestérol sont des composants importants des membranes, les graisses sont des réserves d'énergie et assurent l'isolation et le rembourrage.

2. Les graisses représentent 40 pour cent du régime alimentaire américain, elles devraient être inférieures à 30 pour cent.

3. Le corps a besoin de très peu de graisses polyinsaturées pour fournir les acides gras essentiels, ceux qui ne sont pas fabriqués par le corps lui-même. L'homme est incapable de synthétiser l'acide linoléique, nécessaire à la synthèse de certains phospholipides, il nous faut donc obtenir cet acide gras essentiel.

4. Le cholestérol est utilisé dans la synthèse des acides biliaires et des hormones sexuelles, mais en trop grande quantité, il endommage le système circulatoire.

1. La dégradation des protéines produit l'urée qui est filtrée du sang par les reins. Les régimes spécialisés dans lesquels les protéines sont la principale source d'énergie exercent un stress supplémentaire sur les reins. Le rôle majeur des protéines alimentaires est une source d'acides aminés pour fabriquer de nouvelles molécules.

2. Sur les vingt acides aminés différents contenus dans les protéines, neuf sont essentiels. C'est-à-dire qu'il doit être fourni par l'alimentation dans des aliments tels que la viande, le lait, les œufs, le maïs, les haricots et le soja. Parce que de nombreuses protéines végétales sont déficientes en certains des acides aminés essentiels, les personnes suivant un régime végétarien doivent inclure une variété de plantes dont les protéines ensemble n'en fourniront aucune, ou elles risquent une carence en protéines.

1. Les animaux ont besoin d'une grande variété de minéraux qui sont de petites molécules et éléments inorganiques

2. Les minéraux doivent être obtenus par l'alimentation, soit à partir des aliments, soit dissous dans l'eau.

3. Les minéraux requis comprennent :

une. Ca, Mg, P (os et dents)

b. Na, K (contraction musculaire et conduction de l'influx nerveux)

c. Fe (production d'hémoglobine)

ré. I (trouvée dans les hormones produites par la glande thyroïde)

e. des traces de zinc, de cuivre et de sélénium sont également nécessaires.

1. Les humains ont besoin de petites quantités d'au moins treize molécules organiques appelées vitamines pour aider au métabolisme cellulaire.

2. Les vitamines ne peuvent pas être synthétisées par le corps (en quantités adéquates) et doivent être obtenues à partir de la nourriture.

3. Les vitamines humaines sont regroupées en deux catégories : hydrosolubles et liposolubles.

4. Les vitamines hydrosolubles comprennent la vitamine C et onze composés différents qui composent le complexe de vitamines B qui se dissolvent dans le sang et sont excrétés par les reins. Ces vitamines agissent généralement en conjonction avec des enzymes pour favoriser des réactions chimiques qui fournissent de l'énergie ou synthétisent des matériaux.

5. Les vitamines liposolubles A, D, E et K peuvent être stockées dans la graisse corporelle et peuvent s'accumuler dans le corps au fil du temps. En particulier, la vitamine K aide à réguler la coagulation du sang et la vitamine A est utilisée pour produire des pigments visuels pour l'œil. Les vitamines liposolubles peuvent être toxiques si elles sont consommées à des doses excessivement élevées.

A. Les premiers humains mangeaient des fruits et des légumes, les humains d'aujourd'hui mangent des aliments riches en graisses, en sucre et en sel.

B. Les proportions recommandées dans l'alimentation humaine sont :

1. Glucides complexes : 58-60%

2. Protéines : 12-15%

3. Graisses et autres lipides : 20-25%

C. Une alimentation équilibrée répondra normalement à tous les besoins en ces substances. Un apport excessif est au moins inutile, et au pire nocif.

A. L'énergie contenue dans les nutriments est mesurée en calories. Une calorie est la quantité d'énergie nécessaire pour élever la température de 1 gramme d'eau de 1 degré Celsius. La teneur en calories des aliments est mesurée en unités de calories (1000 calories).

B. Pour maintenir un poids acceptable, l'apport calorique doit équilibrer la production d'énergie. Le corps humain au repos brûle 1550 calories par jour. L'exercice augmente considérablement les besoins caloriques.

C. Les besoins caloriques peuvent être estimés en multipliant votre poids souhaité par 10 (personne inactive), ou 15 (modérément active), ou 20 (très active) puis en soustrayant de 0 à 400 selon l'âge.

25-34 ans soustraire zéro.

35-44 ans soustraire 100

45-54 ans soustraire 200.

55-64 ans soustraire 300.

Plus de 65 soustraire 400.

D. L'obésité est un excès de graisse dans le tissu adipeux du corps, par définition, ce terme s'applique aux personnes qui sont 25 pour cent plus lourdes que l'idéal.

Nutrition et métabolisme organique

A. Les molécules nutritives sont mélangées et remaniées une fois qu'elles ont été absorbées.

B. Peu de temps après un repas, le niveau de glucides augmente, certains sont convertis en graisse pour le stockage, et d'autres sont convertis en glycogène dans le foie et les tissus musculaires.

C. Entre les repas, les niveaux de glucose sont maintenus par la dégradation des réserves de glycogène dans le foie et les acides aminés sont convertis en glucose. Les acides gras des graisses peuvent être utilisés directement par les cellules pour produire de l'énergie.

D. Le foie est un organe précieux pour la conversion des nutriments et la détoxification des produits chimiques.

1. Le système digestif est un espace ou un tube interne avec des régions spécialisées pour le transport, la transformation et le stockage des aliments. une. Un système digestif incomplet a une ouverture.

b. Un système digestif complet est un tube avec deux ouvertures, permettant aux aliments de se déplacer dans une direction à travers la lumière.

2. Le système digestif remplit ces cinq fonctions :

une. Ingestion : la nourriture doit être amenée dans l'organe digestif

b. Décomposition mécanique : la nourriture doit être physiquement décomposée en morceaux, mélangée et transportée.

c. Décomposition chimique : les particules de nourriture doivent être exposées à des enzymes et des hormones qui provoquent la décomposition des grosses molécules en molécules plus petites capables de traverser la muqueuse intestinale.

ré. Absorption : les petites molécules doivent être transportées hors de l'organe digestif et dans le sang et la lymphe.

e. L'élimination est l'expulsion des résidus non digérés et non absorbés à l'extrémité de l'intestin.

1. Digestion intracellulaire : une fois englouti par une cellule, l'aliment est enfermé dans une vacuole alimentaire. La vacuole alimentaire fusionne plus tard avec les lysosomes et la nourriture est décomposée dans la vacuole en molécules plus petites qui peuvent être absorbées dans le cytoplasme cellulaire.

2. Digestion extracellulaire :

une. La cavité gastrovasculaire trouvée chez les cnidaires, tels que l'anémone de mer, l'hydre et la méduse, est une forme de digestion extracellulaire. La nourriture capturée par les tentacules urticants est amenée dans la cavité gastro-vasculaire où les enzymes la décomposent. Les cellules qui tapissent la cavité absorbent les nutriments et engloutissent de petites particules de nourriture où la digestion se poursuit à l'aide de la digestion intracellulaire. Les restes non digérés sont finalement expulsés par la même ouverture par laquelle ils sont entrés.

b. Digestion dans un tube : l'homme et les autres vertébrés ont un tube digestif à plusieurs compartiments où la nourriture est d'abord décomposée physiquement, puis chimiquement avant d'être absorbée par les cellules individuelles. Les animaux à tube digestif utilisent donc la digestion extracellulaire pour décomposer leur nourriture.

3. La spécialisation régionale est en corrélation avec le comportement alimentaire.

une. Les ruminants (par exemple, les vaches) peuvent manger de l'herbe en continu et avoir plusieurs estomacs pour digérer la cellulose.

b. Les estomacs des ruminants ont quatre chambres. La première chambre, le rumen, a évolué en une cuve de fermentation massive comprenant de nombreuses espèces de bactéries et de ciliés qui se développent dans une relation mutuellement bénéfique avec le ruminant. Ces micro-organismes produisent de la cellulase, l'enzyme qui décompose la cellulose en ses sucres composants.

c. Les animaux avec des habitudes alimentaires discontinues peuvent avoir des organes pour le stockage. c'est-à-dire les écureuils

Le système digestif humain (tableau 29-6)

Chapitre 21 Section 3 / Manuel de laboratoire Chapitre 17.1

R. Le système digestif humain mesure plus de 20 pieds de long.

1. Les régions spécialisées comprennent la bouche, le pharynx, l'œsophage, l'estomac, l'intestin grêle, le côlon, le rectum et l'anus.

2. Les glandes accessoires comprennent les glandes salivaires, le foie (avec la vésicule biliaire) et le pancréas.

Le système urinaire et l'homéostasie

A. Le volume et la composition du liquide extracellulaire, qui se compose de liquide interstitiel entourant les cellules vivantes et de sang dans les vaisseaux, est maintenu dans des limites tolérables par le système urinaire.

B. Le système urinaire des mammifères aide à maintenir l'homéostasie de plusieurs manières :

1. Il régule les niveaux sanguins d'ions tels que le sodium, le potassium, le chlorure et le calcium.

2. Il régule la teneur en eau du sang

3. Il maintient le bon pH du sang.

4. Rétention des nutriments importants tels que le glucose et les acides aminés dans le sang.

5. Il sécrète des hormones telles que l'érythropoïétine qui stimule la production de globules rouges

6. Il élimine les déchets cellulaires tels que l'urée.

1. L'eau est obtenue par deux processus : a. L'absorption de l'eau des liquides et des aliments solides se produit dans le tractus gastro-intestinal.

b. Le métabolisme des nutriments donne de l'eau comme sous-produit.

2. L'eau est perdue par au moins quatre processus :

une. L'excrétion de l'eau se fait par excrétion urinaire.

b. L'évaporation se produit à partir des surfaces respiratoires et à travers la peau.

c. La transpiration se produit à la surface de la peau.

ré. L'élimination de l'eau dans les selles est un phénomène normal.

D. Gains et pertes de soluté

1. Les solutés sont ajoutés à l'environnement interne par quatre processus : a. Les nutriments, les ions minéraux, les médicaments et les additifs alimentaires sont absorbés par le tractus gastro-intestinal.

b. La sécrétion des glandes endocrines ajoute des hormones.

c. La respiration met de l'oxygène dans le sang.

ré. Les réactions métaboliques contribuent aux déchets.

2. Les ions minéraux et les déchets métaboliques sont perdus de trois manières :

une. L'excrétion urinaire élimine l'ammoniac (formé à partir d'acides aminés), l'urée (formée dans le foie en joignant deux ammoniac) et l'acide urique (à partir d'acides nucléiques).

b. La respiration élimine le dioxyde de carbone, le déchet métabolique le plus abondant.

c. La transpiration entraîne la perte d'ions minéraux.

Système urinaire des mammifères

1. Les reins (2) filtrent une variété de substances du sang.

une. La majeure partie du filtrat est renvoyée dans le sang, environ 1% se retrouve sous forme d'urine.

b. Les reins régulent le volume et les concentrations de soluté du liquide extracellulaire.

2. L'urine s'écoule de chaque rein à travers un uretère vers une vessie (pour le stockage) puis hors du corps par l'urètre.

3. La miction est une réponse réflexe mais peut être contrôlée par des actions nerveuses et musculaires.

Structure et fonction rénales

A. Chaque rein est une structure en forme de haricot de la taille d'un poing.

1. Une couche dure de tissu conjonctif, la capsule rénale, recouvre chaque rein.

2.À l'intérieur se trouve une région corticale externe recouvrant une région médullaire.

3. Les néphrons constitués de capillaires sanguins et de tubules filtrent l'eau et les solutés du sang et en renvoient une grande partie.

B. Unités fonctionnelles du rein Les néphrons

1. La filtration se produit dans le glomérule, une boule de capillaires nichée dans la capsule de Bowman.

2. La capsule de Bowman recueille le filtrat et le dirige à travers les tubules du néphron continus : proximal -> boucle de Henle -> distal -> canal collecteur.

3. Les capillaires sortent du glomérule, convergent, puis se ramifient à nouveau dans les capillaires péritubulaires autour des tubules du néphron, où ils participent à la récupération de l'eau et des solutés essentiels.

Processus de formation d'urine, un aperçu

1. Lors de la filtration, la pression artérielle force le filtrat hors des capillaires glomérulaires dans la capsule de Bowman, puis dans le tubule proximal.

une. Les cellules sanguines, les protéines et autres gros solutés ne peuvent pas passer la paroi capillaire dans la capsule.

b. L'eau, le glucose, le sodium et l'urée sont expulsés.

2. La réabsorption a lieu dans les parties tubulaires du néphron, où l'eau et les solutés se déplacent à travers la paroi tubulaire, hors du néphron et dans les capillaires environnants.

3. La sécrétion déplace les substances des capillaires vers les parois du néphron.

une. Les capillaires entourant les néphrons sécrètent des quantités excessives d'ions hydrogène et d'ions potassium dans les tubules du néphron.

b. Ce processus débarrasse également le corps des médicaments, de l'acide urique, des produits de dégradation de l'hémoglobine et d'autres déchets.

4. L'urine peut devenir concentrée car il existe un gradient de concentration osmotique de sels et d'urée dans le liquide interstitiel entourant l'anse de Henlé.

A. Facteurs influençant la filtration

1. Les reins peuvent traiter environ 125 ml (environ 4 oz) de sang chaque minute en raison de deux facteurs : a. Les capillaires glomérulaires sont très perméables à l'eau et aux petits solutés.

b. Le sang pénètre dans le glomérule sous haute pression, ces artérioles ont des diamètres plus larges que la plupart des artérioles.

2. La vitesse à laquelle les reins filtrent un volume donné de sang dépend du flux sanguin qui les traverse et de la vitesse de réabsorption dans les tubules.

B. Réabsorption d'eau et de sodium

1. Les mécanismes dans le rein régulent soigneusement l'excrétion et la rétention de substances en fonction de l'apport et des besoins corporels. une. Les ions sodium sont pompés hors du tubule proximal (filtrat) et dans le liquide interstitiel entourant les capillaires péritubulaires.

b. Des quantités importantes d'eau s'écoulent passivement le long du gradient qui a été créé.

c. Dans la branche descendante de l'anse de Henlé, l'eau sort par osmose, mais dans la partie ascendante le sodium est pompé.

ré. Cette interaction des membres de l'anse produit une concentration très élevée de soluté dans les parties les plus profondes de la moelle du rein et délivre une urine plutôt diluée au tubule distal.

2. Ajustements induits par les hormones

une. L'hormone antidiurétique (ADH) de l'hypophyse postérieure est sécrétée en réponse à une diminution du liquide extracellulaire L'ADH rend les tubules distaux et les canaux collecteurs perméables à l'eau, qui retourne dans les capillaires sanguins permettant ainsi à plus d'eau d'être réabsorbée de l'urine .

b. Lorsque les niveaux de sodium chutent, le volume de liquide extracellulaire diminue également, ce qui incite certaines cellules rénales à sécréter de la rénine, qui agit sur le cortex surrénalien pour libérer de l'aldostérone, ce qui favorise la réabsorption du sodium.

c. Lorsque la concentration de soluté dans le liquide extracellulaire augmente, le centre de la soif de l'hypothalamus réagit en diminuant la production de salive, provoquant la soif.

C. Régulation de la pression artérielle et de la teneur en oxygène

1. Deux hormones produites par les reins jouent un rôle important dans la régulation de la pression artérielle et de la capacité de transport de l'oxygène dans le sang, la rénine et l'érythropoïétine.

2. Lorsque la pression artérielle chute, les reins libèrent de la rénine dans la circulation sanguine. La rénine agit comme une enzyme catalysant la formation d'une deuxième hormone, l'angiotensine. L'angiotensine provoque à son tour une constriction des artérioles, ce qui élève la pression artérielle.

3. La constriction des artérioles transportant le sang vers les reins réduit également le taux de filtration du sang, ce qui réduit l'élimination de l'eau du sang. La rétention d'eau provoque une augmentation du volume sanguin et donc une augmentation de la pression artérielle.

4. En réponse à de faibles niveaux d'oxygène dans le sang, les reins libèrent une deuxième hormone, l'érythropoïétine. L'érythropoïétine voyage dans le sang jusqu'à la moelle osseuse où elle stimule une production plus rapide de globules rouges dont le rôle est de transporter l'oxygène.

A. La rétention d'un excès de sodium et d'eau peut entraîner une hypertension.

B. Des dépôts d'acide urique, de sels de calcium et d'autres déchets peuvent se déposer dans le bassinet du rein pour former des calculs rénaux. Aie.

C. Des appareils de dialyse rénale sont nécessaires si les contrôles normaux du volume et de la composition du liquide extracellulaire sont perdus.

1. En hémodialyse, l'appareil est connecté directement à un vaisseau sanguin pour un traitement de quatre heures, trois fois par semaine.

2. En dialyse péritonéale, le liquide est placé dans la cavité abdominale du patient pour servir de milieu pour la dialyse membranaire, puis drainé après un certain temps.

Maintenir la température centrale du corps

R. De nombreuses réponses physiologiques et comportementales différentes aident à maintenir la température interne du corps.

B. Températures adaptées à la vie

1. Les enzymes restent fonctionnelles dans la plage de 0 à 40 o C.

2. Au-dessus de 41 o C, une dénaturation se produit, rendant l'enzyme inefficace.

3. Des températures plus fraîches peuvent ne pas perturber l'activité, mais la ralentir de moitié pour chaque baisse de 10 degrés.

1. Le rayonnement est le gain de chaleur d'une source ou la perte de chaleur du corps vers l'environnement en fonction des températures de l'environnement.

2. La conduction est le transfert de chaleur d'un objet à un autre lorsqu'ils sont en contact direct, comme lorsqu'un humain s'assoit sur du béton froid (ou chaud !).

3. La convection est le transfert de chaleur au moyen d'un fluide en mouvement tel que l'air ou l'eau.

4. L'évaporation est un processus par lequel une substance chauffée passe d'un état liquide à un état gazeux, avec une perte de chaleur dans l'environnement.

Classification des animaux en fonction de la température

1. Les animaux à faible métabolisme tirent leur chaleur de l'environnement.

2. Les ectothermes, tels que les lézards, s'adaptent aux changements de température externes dans ce que nous appelons la régulation comportementale de la température.

1. Les endothermes génèrent de la chaleur à partir de l'activité métabolique et exercent également des contrôles sur la conservation et la dissipation de la chaleur.

2. Les endothermes ont des adaptations telles que les plumes, la fourrure ou la graisse pour réduire les pertes de chaleur. Ils ajustent également leur comportement en se déplaçant sous terre pendant la chaleur de la journée, par exemple.

C. Les hétérothermes, comme le colibri, génèrent de la chaleur corporelle pendant leurs périodes d'activité mais ressemblent aux ectothermes pendant les périodes d'inactivité.

D. Stratégies thermiques comparées

1. Les ectothermes sont avantagés sous les tropiques où ils n'ont pas à dépenser beaucoup d'énergie pour maintenir la température corporelle.

2. Les endothermes ont un avantage dans les environnements modérés à froids.

Régulation de la température chez les mammifères

A. Réponses au stress dû au froid

1. Les mammifères réagissent au froid en contractant les muscles lisses des vaisseaux sanguins de la peau (vasoconstriction périphérique), ce qui retarde la perte de chaleur.

2. Dans la réponse pilomotrice, les poils ou les plumes deviennent plus dressés pour créer une couche d'air immobile qui réduit les pertes de chaleur convective et radiative.

3. Les tremblements rythmiques (frissons) sont une réponse courante au froid mais ne sont pas efficaces très longtemps et ont un coût métabolique élevé.

4. Les mammifères en hibernation peuvent produire de la chaleur sans frisson par une stimulation hormonale d'un tissu adipeux brun spécial.

5. L'hypothermie est une condition dans laquelle la température centrale chute en dessous de la normale, elle peut entraîner des lésions cérébrales et les gelures mortelles sont la mort cellulaire localisée due au gel.

B. Réponses au stress thermique

1. La vasodilatation périphérique est l'élargissement du diamètre des vaisseaux sanguins pour permettre à de plus grands volumes de sang d'atteindre la peau et de dissiper la chaleur.

2. La perte de chaleur par évaporation par transpiration est un mécanisme de refroidissement courant et évident.

3. L'halètement est utilisé par les animaux ayant très peu de capacité à transpirer.

4. L'hyperthermie est une élévation de la température centrale, avec des effets dévastateurs.

1. Pendant une fièvre, l'hypothalamus réinitialise le « thermostat » du corps à une nouvelle température centrale temporaire. une. Au début de la fièvre, la perte de chaleur diminue et la production de chaleur augmente, la personne a froid.

b. Lorsque la fièvre tombe, la vasodilatation périphérique et la transpiration augmentent alors que le corps tente de ramener la température centrale à la normale.

2. L'augmentation contrôlée de la température corporelle (dans certaines limites) au cours d'une fièvre semble renforcer la réponse immunitaire de l'organisme.

Copyright 2000 par Steven Wormsley
Dernière mise à jour le 5 janvier 2000 par Steven Wormsley


Cellules de flammes de planaires et néphridies de vers

Au fur et à mesure que les systèmes multicellulaires ont évolué pour avoir des systèmes d'organes qui divisent les besoins métaboliques du corps, les organes individuels ont évolué pour remplir la fonction d'excrétion. Les planaires sont des vers plats qui vivent dans l'eau douce. Leur système excréteur se compose de deux tubules reliés à un système de conduits très ramifié. Les cellules des tubules sont appelées cellules de flamme (ou protonéphridie ) parce qu'ils ont un groupe de cils qui ressemble à une flamme vacillante lorsqu'on les regarde au microscope, comme illustré à la figure 22.10 une . Les cils propulsent les déchets dans les tubules et hors du corps à travers les pores excréteurs qui s'ouvrent à la surface du corps, les cils puisent également l'eau du liquide interstitiel, permettant la filtration. Tous les métabolites précieux sont récupérés par réabsorption. Les cellules de flamme se trouvent dans les vers plats, y compris les ténias parasites et les planaires libres. Ils maintiennent également l'équilibre osmotique de l'organisme.

Graphique 22.10. Dans le système excréteur de (a) planaires, les cils des cellules de flamme propulsent les déchets à travers un tubule formé par une cellule tubulaire. Les tubules sont reliés à des structures ramifiées qui mènent à des pores situés tout le long des côtés du corps. Le filtrat est sécrété à travers ces pores. Dans (b) les annélides tels que les vers de terre, les néphridies filtrent le liquide du coelome ou de la cavité corporelle. En battant les cils à l'ouverture de la néphridium, l'eau du coelome est attirée dans un tubule. Au fur et à mesure que le filtrat descend dans les tubules, les nutriments et autres solutés sont réabsorbés par les capillaires. Le fluide filtré contenant des déchets azotés et autres est stocké dans une vessie puis sécrété par un pore sur le côté du corps.

Les vers de terre (annélides) ont des structures excrétrices légèrement plus évoluées appelées néphridie , illustré à la figure 22.10 b . Une paire de néphridies est présente sur chaque segment du ver de terre. Ils sont similaires aux cellules de flamme en ce qu'ils ont un tubule avec des cils. L'excrétion se fait par un pore appelé néphridiopore . Elles sont plus évoluées que les cellules flammes dans la mesure où elles possèdent un système de réabsorption tubulaire par un réseau capillaire avant excrétion.


Discussion

Notre objectif était de caractériser les principaux ajustements métaboliques d'un hibernant lors d'un jeûne prolongé dans des conditions normothermiques, et d'évaluer les effets saisonniers possibles. Cette étude montre que les marmottes utilisent une double stratégie pour faire face au jeûne normothermique : (1) elles abaissent rapidement leur taux métabolique (à moins qu'elles ne fonctionnent déjà à des taux très bas comme au printemps), réduisant éventuellement la dépense énergétique au niveau le plus bas encore compatible avec vie normothermique, et (2) ils réorganisent leur modèle de sélection de carburant pour épargner des réserves limitées de protéines.

Dépression métabolique induite par le jeûne

A l'état nourri, le taux métabolique est beaucoup plus élevé en été qu'au printemps (+35 % voir tableau 1), et cette observation est cohérente avec les mesures publiées sur les marmottes et les marmottes post-absorption (Bailey, 1965 Körtner et Heldmaier, 1995 Rawson et al., 1998). Après l'éveil du printemps, un faible taux métabolique basal semble critique pour survivre à la période de jeûne normothermique qui suit généralement 5 mois d'hibernation (Davis, 1967 Hamilton, 1934 Snyder et al., 1961). Pendant le jeûne, la dépression métabolique n'était utilisée qu'en été (réduction de 25 % de O2 sur 2 semaines Fig. 2), et il ne s'est pas produit au printemps. Cette observation suggère la possibilité intéressante que le métabolisme basal normothermique ait une limite inférieure. L'existence potentielle d'un métabolisme de base minimum pour les mammifères normothermes est étayée par le fait que les marmottes d'été et de printemps atteignent le même taux de dépense énergétique après 14 jours de jeûne, même si leurs taux avant le jeûne sont très différents. Les mesures sur les lapins fournissent un support supplémentaire pour le même concept car cette espèce commence avec un taux métabolique post-absorption beaucoup plus élevé que les marmottes printanières ou estivales, mais elle montre une dépression métabolique plus forte pendant le jeûne (-32% en seulement 7 jours). La diminution rapide de la dépense énergétique montrée par les lapins est insuffisante pour compenser complètement leur taux métabolique post-absorption élevé (tableau 1, figure 2A), et, par conséquent, la perte de masse corporelle est beaucoup plus rapide chez les lapins (-15% dans 7 jours) que chez les marmottes (-13% en 14 jours) (Fig. 1). Pour cette raison, les expériences sur le lapin ont dû être terminées après 1 semaine (selon la limite fixée par notre comité de protection des animaux), et nous n'avons pas pu déterminer si une période de jeûne plus longue finirait par réduire le taux métabolique des lapins à des niveaux inférieurs. observé chez les marmottes. Chez les deux espèces, la dépression métabolique s'accompagnait d'une diminution faible mais significative de la température corporelle (Fig. 3), comme on l'avait déjà observé chez d'autres espèces, dont le rat (Ma et Foster, 1986). Comme les marmottes printanières, d'autres mammifères avec des taux métaboliques basaux naturellement faibles semblent ne pas avoir la capacité de dépression métabolique pendant le jeûne. Expériences sur l'opossum de Virginie Didelphis virginiana, un marsupial de taille corporelle similaire (3-4 kg), a révélé que cette espèce nocturne atteint son taux métabolique le plus bas de ∼200 μmol O2 kg -1 min -1 (ou 4,5 ml O2 kg -1 min -1 )pendant le sommeil diurne (voir fig. 1 dans Weber et O'Connor, 2000). Ce taux post-absorption minimum est identique à la valeur la plus basse observée ici chez les marmottes (Fig. 2A) et l'opossum de Virginie n'est pas capable de diminuer davantage son taux métabolique en réponse au jeûne (Weber et O'Connor, 2000).

Les deux principaux processus consommant de l'ATP qui expliquent le taux métabolique basal sont le pompage ionique transmembranaire et la synthèse des protéines (Rolfe et Brown, 1997). Il est concevable que les mammifères ne puissent réguler à la baisse ces processus essentiels qu'à un niveau minimal, en dessous duquel la vie normothermique est compromise. Par exemple, il est possible de réduire le coût du pompage ionique en diminuant la fuite ionique des membranes grâce à des modifications du degré de saturation des phospholipides (Hulbert et Else, 2000). Cependant, la modification de la saturation des phospholipides affectera également de nombreuses autres fonctions membranaires importantes par le biais de modifications de la fluidité globale (par exemple, la sensibilité à l'insuline), et une telle perturbation généralisée peut ne pas être compatible avec la vie des mammifères à ∼37°C. Une autre façon de réduire la dépense énergétique pendant le jeûne serait de réduire la fuite de protons mitochondriaux, un processus qui découple la consommation d'oxygène de la phosphorylation de l'ADP. Deux études récentes montrent que le jeûne et la restriction calorique n'affectent pas la fuite de protons (Bézaire et al., 2001 Ramsay et al., 2004), alors qu'une autre suggère que la fuite de protons est diminuée passant par mécanismes complexes qui varient avec la durée de la restriction calorique (Bevilacqua et al., 2004). De toute évidence, l'existence potentielle d'un taux métabolique normothermique minimum dans les endothermes, et les limitations mécanistiques de son point de consigne spécifique, justifient une enquête plus approfondie.

Changements dans la sélection des carburants : épargner les protéines

En plus de la dépression métabolique, le jeûne prolongé a des effets importants sur la sélection de carburant. Dans nos expériences, les principaux changements provoqués par la privation de nourriture ont eu lieu dans les 2 jours et, par conséquent, toutes les valeurs mesurées après cette période ont été regroupées pour chaque groupe d'animaux (Fig. 4). Chez les deux espèces, l'utilisation dominante de glucides qui soutiennent normalement le métabolisme énergétique dans l'état post-absorption (phase I) a été rapidement remplacée par une utilisation élevée de lipides (phase II) alors que le jeûne se poursuivait (Fig. 4). Cependant, les différences les plus frappantes dans la sélection des carburants ont été observées en ce qui concerne l'épargne protéique. Au printemps, les marmottes avaient le taux le plus faible d'oxydation nette des protéines, probablement parce que leur modèle de sélection de combustible reflétait plus étroitement l'état d'hibernation qu'en été. À l'état nourri, les protéines ne représentaient que 8 % du taux métabolique chez les marmottes printanières, alors qu'elles atteignaient 17 %.O2 chez les marmottes d'été, et une valeur élevée de 28%O2 chez le lapin (Fig. 4A). Tous les groupes avaient la capacité de diminuer les taux absolus et relatifs d'oxydation nette des protéines en réponse au jeûne. Après plus de 3 jours sans nourriture, la contribution des protéines a été réduite à 5%O2 chez les marmottes printanières, 6%O2 en marmottes d'été et 20%O2 chez les lapins. Par conséquent, les marmottes montrent une capacité supérieure à épargner les protéines (également reflétée par des taux de consommation d'eau et de production d'urine beaucoup plus faibles que les lapins, voir Fig. 6), en particulier pendant l'été. À cette période de l'année, ils peuvent non seulement réduire leur taux global de dépense énergétique pour faire face au jeûne, mais aussi réduire considérablement leur dépendance aux protéines. Cette stratégie métabolique permet de conserver la masse musculaire et elle a été observée chez d'autres espèces adaptées au jeûne prolongé. Les phoques adultes reproducteurs et les bébés phoques post-sevrage vivent généralement plusieurs semaines sans nourriture en réduisant leur taux métabolique à ∼45% des valeurs normales chez les animaux nourris et leur dépendance aux protéines jusqu'à 6% de O2(Nørdoy et al., 1993, 1990 Worthy et Lavigne, 1987). Cependant, la capacité la plus extrême d'épargner les protéines peut être trouvée chez les ours. Pendant l'été, la récession de la banquise empêche les ours polaires U. maritimus provenant de la chasse aux phoques et ils semblent réduire l'oxydation des protéines à 1 % de O2 en réponse au jeûne (Atkinson et al., 1996 Nelson, 1987). Les ours noirs Ursus américain et les grizzlis U. arctos diminuent la température corporelle de quelques degrés et le taux métabolique de ∼ 30 % pendant leur « pseudo-hibernation », qui peut durer jusqu'à 6 mois (Watts et al., 1981). Pendant ce temps, aucun déchet azoté n'est excrété (Barboza et al., 1997 Nelson, 1973, 1980 Nelson et al., 1973) et deux mécanismes possibles ont été invoqués pour expliquer cette observation : (1) une inhibition complète de l'oxydation des protéines et /ou (2) le recyclage des déchets azotés. Des expériences plus récentes où des biopsies musculaires ont été prélevées au début et à la fin de l'hiver montrent que la dégradation des protéines chez les ours en hibernation est en fait importante mais faible (Tinker et al., 1998).Par conséquent, ils ont la capacité de recycler l'azote car aucun déchet ne s'accumule pendant l'hibernation.


Mots à connaitre

Hormone antidiurétique: Produit chimique sécrété par l'hypophyse qui régule la quantité d'eau excrétée par les reins.

Hémodialyse: Processus de séparation des déchets du sang par passage à travers une membrane semi-perméable.

Néphron : Unité filtrante du rein.

Urée: Composé chimique de carbone, d'hydrogène, d'azote et d'oxygène produit sous forme de déchets par les cellules qui décomposent les protéines.

Uretère: Tube qui transporte l'urine d'un rein à la vessie.

Urètre: Conduit menant de la vessie à l'extérieur du corps par lequel l'urine est éliminée.

Le liquide contenant des déchets qui reste dans les néphrons est appelé urine. L'urine est constituée à 95 pour cent d'eau, dans laquelle les déchets sont dissous. Une paire de tubes appelés uretères transportent l'urine des reins vers la vessie. Chaque uretère mesure environ 16 à 18 pouces (40 à 45 centimètres) de long. La vessie est un sac musculaire creux situé dans le bassin qui est affaissé lorsqu'il est vide, mais en forme de poire et distendu lorsqu'il est plein. La vessie d'un adulte peut contenir plus de 2 tasses (0,6 litre) d'urine. La vessie vide l'urine dans l'urètre, un conduit menant à l'extérieur du corps. Chez les hommes, l'urètre mesure environ 20 cm de long. Chez les femelles, il mesure moins de 2 pouces (5 centimètres) de long. Un muscle du sphincter autour de l'urètre à la base de la vessie contrôle le flux d'urine entre les deux.

Le volume d'urine excrété est contrôlé par l'hormone antidiurétique (ADH), qui est libérée par l'hypophyse (une petite glande située à la base du crâne). Si une personne transpire beaucoup ou ne boit pas suffisamment d'eau, des cellules nerveuses spéciales de l'hypothalamus (une région du cerveau contrôlant la température corporelle, la faim et la soif) détectent la faible concentration d'eau dans le sang. Ils signalent ensuite à l'hypophyse de libérer l'ADH dans le sang, où il se rend aux reins. En présence d'ADH, les reins réabsorbent plus d'eau de l'urine et la renvoient dans le sang. Le volume d'urine est ainsi réduit. En revanche, si un individu absorbe trop d'eau, la production d'ADH diminue. Les reins ne réabsorbent pas autant d'eau et le volume d'urine est augmenté. L'alcool inhibe la production d'ADH et augmente donc la production d'urine.


Méthodes

Milieu et souches

Toutes les souches utilisées dans cette étude sont répertoriées dans le tableau S1. Toute la nomenclature des levures suit la convention standard. Pour toutes les expériences, des souches de levure congelées stockées à -80°C ont d'abord été frappées sur des plaques YPD (10 g/L d'extrait de levure, 20 g/L de peptone, 20 g/L de glucose + 2% d'agar) et cultivées à 30°C pendant environ 48 heures, à partir desquelles une seule colonie a été inoculée dans 3 ml de YPD et cultivée pendant une nuit à 30°C sous agitation. Toutes les expériences ont été réalisées dans les 5 jours suivant la génération de la culture d'une nuit. Le milieu minimal (SD) contenait 6,7 g/L de base d'azote de levure Difco sans acides aminés mais avec du sulfate d'ammonium (Thermo Fisher Scientific, Waltham, MA, USA) et 20 g/L de D-glucose, sauf pendant les expériences de limitation du glucose, dans lesquelles des niveaux inférieurs de glucose ont été utilisés comme spécifié. Le milieu de privation de glucose (S) ne comprenait que 6,7 g/L de base d'azote de levure Difco sans acides aminés mais avec du sulfate d'ammonium. Le milieu de privation d'azote (SD-N) contenait 1,7 g/L de base d'azote de levure Difco sans acides aminés ni sulfate d'ammonium et 20 g/L de D-glucose. Selon l'auxotrophie de la souche, SD a été complété par de la lysine (164,3 M), du sulfate d'adénine (108,6 M) [74] ou des organosulfures (134 M) afin que les cellules puissent croître de façon exponentielle.

Les souches ont été construites soit par croisement de levures, soit par recombinaison homologue [74,75]. Les croisements ont été effectués par accouplement de souches parentales, tirage de diploïdes, sporulation, dissection en tétrades et sélection sur des plaques appropriées. A titre d'exemple de délétion de gène, le bcy1La souche Δ (WY2527) a été construite en amplifiant par PCR le gène de résistance KanMX à partir d'un plasmide (WSB26 [76]) en utilisant les amorces WSO671 (TACAACAAGCAGATTATTTTCAAAAGACAACAGTAAGAATAAACGcagctgaagcttcgtacgc) et WSO672 (GAGAGAGAGAAGGGAAATTTAGGTGGTCATTACTATTAGATCt et en aval de la BCY1 gène, respectivement. Les lys - la souche WY2490 a ensuite été transformée avec le produit PCR, et les transformants ont été sélectionnés sur une plaque G418. La suppression réussie a été confirmée par une PCR de contrôle avec une amorce en amont de la BCY1 (WSO673 TATACTGTGCTCGGATTCCG) associé à une amorce interne pour la cassette KanMX amplifiée (WSO161 ctaaatgtacgggcgacagt).

Évolution

L'évolution de la coculture a été décrite dans une étude antérieure [32]. Pour relancer une coculture, environ 20 L ont été prélevés dans l'échantillon congelé à l'aide d'une spatule métallique stérile, dilués environ 10 fois dans SD et laissés croître jusqu'à une turbidité modérée pendant 1 à 2 jours. La coculture a été encore élargie en ajoutant 3 ml de SD. Évolué lys − les clones ont été isolés en étalant la coculture sur gélose en milieu riche (YPD) avec de l'hygromycine B.

Pour l'évolution de la monoculture, des récipients chimiostatiques (Fig S14) ont été utilisés (Methods, "Chemostats and turbidostats"). Pour créer un environnement stérile, l'assemblage initial a été effectué dans des plateaux d'autoclave, avec des récipients maintenus dans des supports de tubes. Six réservoirs ont été préparés en ajoutant 810 ml d'eau à chaque bouteille. Six récipients ont été préparés en ajoutant une barre d'agitation de 10 mm et 20 ml de milieu de croissance (SD + 21 M de lysine) dans chaque récipient. La tubulure de distribution du milieu a été fixée entre les réservoirs et les récipients par des bouchons en caoutchouc, et la tubulure d'évacuation a été fixée à chaque bras de sortie, l'extrémité non fixée étant recouverte d'une feuille maintenue en place par du ruban autoclave. Un tube de microcentrifugation de 1,5 ml a été placé sur l'aiguille de prélèvement et maintenu en place par du ruban autoclave. Les orifices des tubes étaient également enveloppés de papier d'aluminium. Chaque réservoir avec sa tubulure attachée a été pesé, l'ensemble entier a été autoclavé, puis chaque réservoir a été pesé à nouveau. L'eau perdue a été calculée et rajoutée. Dans des conditions stériles, 90 mL de SD 10X et un stock de lysine ont été ajoutés à chaque réservoir pour atteindre une concentration finale en lysine de 21 µM. Les récipients ont ensuite été fixés dans les réceptacles du collecteur du chemostat, les réservoirs placés sur les balances et les tubes vissés dans les pompes.

Ancêtre ou évolué lys − les clones ont été cultivés dans 50 mL SD + 164 M de lysine pendant environ 20 heures avant l'inoculation. Avant chaque expérience, la croissance a été suivie pour s'assurer que les cellules se développaient de manière optimale (temps de doublement d'environ 1,6 heure). Lorsque les cellules ont atteint une densité d'environ 0,2 DO600, les cellules ont été lavées 3 fois dans SD et inoculées dans un récipient chemostat prérempli avec SD + 21 M de lysine. Après cette étape, les pompes chimiostatiques ont été allumées à un temps de doublement défini dans le progiciel LabView personnalisé. Chaque récipient de chemostat contenait environ 43 ml de volume courant et était réglé sur un temps de doublement cible (par exemple, pour un doublement de 7 heures, le débit est de 43 × dans2/7 = environ 4,25 mL/h). Nous avons évolué 3 lignes au doublement à 7 heures et 3 lignes au doublement à 11 heures. Avec 21 M de lysine dans le réservoir, la densité cellulaire cible à l'état d'équilibre était de 7 × 10 6 /mL. En réalité, les densités de cellules vivantes variaient entre 4 × 10 6 /ml et 1,2 × 10 7 /ml. Périodiquement, 4 ml de surnageant ont été récoltés et distribués dans un tube conique stérile de 15 ml. Ensuite, 300 L de cet échantillon cellulaire ont été prélevés et conservés sur de la glace pour une analyse par cytométrie en flux. Les 3,7 ml restants de surnageant ont été filtrés à travers un filtre en nylon de 0,22 µm en aliquotes de 500 µL et congelés à -80°C. Chaque chémostat a été échantillonné selon une séquence prédéfinie. Pour les expériences d'extraction de métabolite, le bouchon du récipient chemostat a été retiré et les cellules de 20 ml d'échantillon ont été récoltées (Méthodes, « Extraction de métabolite) ». En raison de la rupture de la stérilité des vaisseaux, cela marquerait la fin de l'expérience du chémostat.

Le réservoir de nutriments a été rempli si nécessaire en injectant du milieu à travers un filtre stérile de 0,2 µm monté sur une seringue de 60 ml. Pour prélever des échantillons de manière stérile, le tube de protection de l'aiguille d'échantillonnage a été soigneusement soulevé et une seringue stérile de 5 ml a été fixée à l'aiguille. L'aiguille a ensuite été essuyée avec de l'éthanol à 95 % et enfoncée lentement de sorte que la pointe soit au moins approximativement 10 mm en dessous du niveau de liquide. Un échantillon de 5 ml a été aspiré dans la seringue, l'aiguille tirée au-dessus de la surface du liquide, et 1 ml d'air supplémentaire a été aspiré pour débarrasser l'aiguille des résidus liquides. La seringue a ensuite été détachée et le capuchon a été remis sur l'aiguille. Les échantillons ont été éjectés dans des tubes de culture stériles de 13 mm pour la congélation et la détermination par cytométrie en flux des densités de cellules vivantes. Dans les deux expériences d'évolution, les échantillons ont été congelés dans 1 partie de tréhalose à 20 % dans du tampon phosphate de sodium 50 mM (pH 6,0) + 1 partie de YPD. Les échantillons ont été refroidis à 4°C pendant 15 min avant d'être congelés à -80°C.

Le séquençage du génome entier et l'analyse des données sont décrits en détail dans [32].

Quantification de la fréquence auxotrophe

Les cultures congelées (2 points dans le temps de 3 expériences d'évolution en monoculture et 3 expériences d'évolution en coculture) ont été revivifiées, et les clones ont été isolés et criblés pour l'auxotrophie. Nous avons relancé des échantillons congelés en étalant directement des échantillons sur YPD (monoculture) ou YPD + hygromycine (cocultures à sélectionner contre la souche partenaire). Les plaques ont été cultivées à 30 °C pendant environ 2 à 4 jours jusqu'à ce que toutes les colonies soient facilement visibles pour le prélèvement. Nous avons observé une variété de tailles de colonies et examiné des colonies de grande et de petite taille lorsqu'elles étaient toutes deux présentes. Nous avons compté les grandes et les petites colonies pour estimer le rapport grandes/petites cellules formant des colonies dans la population, puis multiplié cette fraction par la fraction d'auxotrophes observée dans chaque classe de taille de colonie pour obtenir une estimation complète de la fréquence des auxotrophes de la population. Pour cribler l'auxotrophie, des colonies entières ont été inoculées dans 150 L de SD, dont 10 L ont été dilués dans 150 L de SD dans des plaques de microtitration et incubées pendant la nuit pour épuiser le transfert d'organosulfure ou le stockage cellulaire d'organosulfure. Dans le cas de certaines petites colonies, aucune dilution n'a été effectuée car la densité cellulaire inoculée était déjà suffisamment faible, sur la base des mesures de DO. Ensuite, 10 à 30 L ont été dilués dans un volume final de 150 L chacun de SD + 164 M de lysine, SD + 164 M de lysine + 134 M de méthionine et YPD, visant une DO d'environ 0,005 à 0,03 sur la base d'une lecture initiale de une plaque 96 puits OD600 lecture de la plaque de famine. Les plaques ont ensuite été incubées pendant plus de 48 heures pour faire croître les cultures jusqu'à saturation et la turbidité de la culture (DO600) a été lu à l'aide d'un lecteur de plaques 96 puits. Puits de contrôle connus lysorgS − (WY1604) et lys − (WY2226) ont été inclus dans le dépistage en tant que témoins. Les puits qui ont poussé dans SD + lysine + méthionine et YPD mais n'ont pas poussé dans SD + lysine ont été classés comme lysorgS − .

Microscopie à fluorescence

Les expériences de microscopie à fluorescence et l'analyse des données sont décrites en détail ailleurs [27]. En bref, le microscope est connecté à une caméra CCD refroidie pour l'imagerie en fluorescence et en lumière transmise. Le microscope abrite une chambre à température contrôlée réglée à 30°C. Le microscope est équipé de cubes filtrants commutables motorisés capables de détecter une variété de fluorophores. Il dispose également d'étages motorisés pour permettre la mise au point automatique z et le balayage xy systématique des emplacements dans les puits de la microplaque. L'acquisition d'images est effectuée avec un programme interne LabVIEW, intégrant une mise au point automatique en fond clair et un réglage automatique de l'exposition pendant l'imagerie par fluorescence pour éviter la saturation. Une analyse précédente [27] a démontré que si la fluorescence par cellule est constante dans le temps, l'intensité de fluorescence soustraite du bruit de fond s'échelonne proportionnellement à la densité de cellules vivantes, et une diminution de l'intensité de fluorescence est bien corrélée avec la mort cellulaire.

Pour les expériences de la Fig 2 et de la Fig S2, WY2490 (lys − ) et WY2527 (lysbcy1 − ) ont été cultivés pendant la nuit jusqu'à la phase exponentielle dans SD + 164 M de lysine, lavés 3 fois dans du milieu S et privés de nourriture pendant 3 heures à 30 °C dans des tubes à essai de 13 mm nettoyés en usine dans SD (privation de lysine) ou S ( lysine et privation de carbone). Pour l'imagerie, environ 10 000 cellules/puits ont été ensemencées dans chaque puits d'une plaque de 96 puits dans le milieu correspondant (le traitement à la rapamycine a été effectué en SD + 1 M de rapamycine). La plaque de microtitration a été imagée périodiquement (environ 1 à 2 h) sous un objectif 10× dans un microscope à fluorescence inversé Nikon Eclipse TE-2000U (Nikon, Tokyo, Japon) à l'aide d'un filtre cube ET DsRed (excitateur : ET545/30x, émetteur : ET620/60m, Dichroïque : T570LP). Un protocole similaire a été suivi pour les expériences des figures 6 et S9, S10 et S11, avec les génotypes et les conditions de famine notés dans les légendes des figures correspondantes.

Chemostats et turbidostats

Les cellules ont été cultivées dans des conditions contrôlées à l'aide d'un dispositif de culture continue sur mesure (S14A Fig), avec 6 canaux (S14C Fig) dont chacun peut fonctionner indépendamment comme un chemostat ou un turbidostat. Lorsqu'il est utilisé comme un chémostat, un canal fournit un environnement nutritif limité dans lequel le taux de croissance est maintenu constant. Lorsqu'il fonctionne comme un turbidostat, un canal maintient une densité cellulaire constante tandis que les cellules se développent avec un approvisionnement abondant en nutriments. Pour les protocoles de croissance cellulaire dans ces appareils, voir Méthodes, « Évolution ».

Le dispositif de culture continue se composait de 6 cuves de réacteur (S14A Fig, arrière), chacune avec un volume d'environ 43 ml (S14E Fig) déterminé par la hauteur du tube de sortie (S14C Fig). Un bouchon en caoutchouc équipé d'un tube d'arrivée et d'une aiguille d'échantillonnage recouvrait le dessus de chaque récipient (S14C Fig). Les récipients ont été placés dans un cadre de montage en aluminium avec 6 réceptacles (S14A Fig, arrière), chacun équipé d'un agitateur magnétique intégré (fabriqué à partir d'un ventilateur CPU) et d'un détecteur optique à phototransistor LED pour les mesures de DO. Les vaisseaux étaient immobilisés dans les réceptacles par des bagues de compression réglables. Une aiguille d'échantillonnage a traversé une courte longueur de tube en caoutchouc PharMed (S14C Fig). Le tube était maintenu en place par un tube de verre inséré dans le bouchon. Des attaches zippées sont utilisées pour obtenir la bonne étanchéité, permettant le mouvement de l'aiguille d'échantillonnage tout en appliquant suffisamment de friction pour maintenir la position. Les déchets s'écoulaient par gravité vers un réceptacle à déchets sous l'appareil à travers un tube de 0,375 pouce de diamètre intérieur (Cole Parmer C-Flex) fixé au bras de sortie. Les milieux nutritifs ont été introduits dans chaque récipient à partir d'un réservoir indépendant par une pompe péristaltique (Welco WPM1, fonctionnant à 7 V CC Welco, Tokyo, Japon). Le tube de distribution du milieu se composait de 2 sections de tube PTFE générique de 2 mm de diamètre extérieur et de 1 mm de diamètre intérieur, reliées par insertion dans les 2 extrémités d'une section de 17 cm de tube PharMed AY242409 (Saint-Gobain, Courbevoie, France) qui a été inséré dans la pompe péristaltique (S14B Fig). La pompe a été activée et désactivée par le programme LabView personnalisé via un boîtier de relais (Pencom Design, UB-RLY-ISO-EXT-LR Trumbauersville, PA, USA). Selon qu'un canal donné était en mode chémostat ou turbidostat, le programme LabView contrôlait la pompe de différentes manières (c. Les données de DO et de débit ont été enregistrées pour l'un ou l'autre mode de fonctionnement. Dans les deux cas, le débit peut être utilisé pour calculer le taux de croissance. Les réservoirs de média (fig. S14A, à l'avant) étaient des bouteilles en verre de 1 L bouchées avec des bouchons en caoutchouc à un trou, et une section de tube en verre a été utilisée comme manchon pour empêcher l'enroulement du tube en PTFE et pour que l'extrémité du tube en PTFE touche le fond du réservoir. Chaque réservoir a été placé sur une balance numérique (Ohaus SPX2201 Parsippany, NJ, USA) avec une interface numérique (interface Ohaus Scout RS232) pour mesurer le volume (poids) restant dans le réservoir à un moment donné.

En mode turbidostat, une turbidité moyenne constante a été maintenue. Plus précisément, la pompe était activée lorsque la DO mesurée était supérieure au point de consigne et désactivée lorsque la DO était inférieure au point de consigne. La DO a été mesurée à l'aide d'une LED de 940 nm (Ledtech UT188X-81-940, alimentée par un courant de 50 mA Taiwan, Taiwan) et d'un phototransistor (Ledtech LT959X-91-0125). Chaque paire LED-phototransistor a été testée et sélectionnée pour des mesures de DO cohérentes. La LED et le phototransistor ont été positionnés par des trous de montage sur le cadre métallique en aluminium, sur les côtés opposés de la cuve du réacteur, à 4 cm du fond de la cuve. Chaque phototransistor était connecté à un circuit d'amplificateur opérationnel (LM324) qui agissait comme un convertisseur courant-tension et un tampon (S14B Fig). Un convertisseur DC-DC isolé a fourni une alimentation en tension régulée pour l'électronique. La tension de sortie du circuit photodétecteur a été numérisée à l'aide d'un DAQ (National Instruments USB-6009 Austin, TX, États-Unis) et lue par le programme LabView pour la mesure de la DO. Le programme LabView a enregistré l'intensité lumineuse moyenne I0 au cours des 2 premières minutes après le démarrage d'un canal comme valeur « vide ». L'intensité lumineuse, I, a été mesurée toutes les 30 s environ, et la DO = log10(je/je0) a été calculé.

En mode chémostat, un débit moyen constant F de milieu dans le récipient a été maintenu. Contrairement à notre configuration précédente de chemostat [77], ici, un débit constant a été obtenu via une balance (Ohaus SPX2201) qui pesait constamment son réservoir associé, et la lecture a été acquise via une interface RS232 (Ohaus Scout RS232). La lecture initiale de l'échelle, Minitiale, a été enregistré lorsque le canal chemostat a été activé ou réinitialisé. Ceci a été utilisé avec la lecture de l'échelle actuelle Mcourant pour calculer le volume total pompé du réservoir au récipient comme 1 ml/g × (McourantMinitiale). Le volume cible qui aurait dû s'écouler du réservoir au navire à l'heure actuelle a été calculé en fonction du débit prédéfini. Si le volume total était inférieur à la cible, la pompe était activée, et sinon, la pompe était désactivée. Cela a fourni le débit moyen correct. Le débit a été choisi pour le temps de doublement souhaité, F = dans(2) × V/T, où V est le volume du vaisseau et T le temps de doublement. Les volumes des récipients ont été calculés en pesant un récipient vide, puis en le pesant à nouveau lorsqu'il est rempli jusqu'au point de débordement (S14E Fig), donnant une valeur moyenne de 43 ml. Les débits individuels ont été déterminés à l'aide de volumes de récipients individuels. Les mesures de volume sont limitées par la taille minimale des gouttes du tube de déchets d'environ 0,5 ml, qui est limitée par la tension superficielle. Les lectures d'échelle ont été enregistrées, fournissant une mesure du débit (S14D Fig).

Essais biologiques

La plupart des essais biologiques sont basés sur le rendement. WY1604 (rencontré10 − ) servait généralement de souche test, sauf indication contraire dans une expérience (voir la figure S5 et le tableau S1), mais la préparation pour tous les essais biologiques basés sur le rendement était la même.Les souches ont été cultivées pendant environ 16 heures dans 3 ml de SD, avec tous les suppléments nécessaires ajoutés. Pendant ce temps, le taux de croissance a été suivi pour s'assurer que les cellules doublaient comme prévu (doublement de 1,6 à 3 heures selon la souche/condition). Après ce temps, les cellules ont reçu 3 à 5 lavages avec 3 ml de SD + 164 M de lysine (sans aucun supplément d'organosulfure) et ont été affamées pendant au moins 3 heures à 30 °C dans 3 ml de SD + 164 M de lysine pour épuiser les réserves cellulaires d'organosulfures. . La famine a été effectuée dans un tube à essai de 13 mm nettoyé en usine pour éviter une contamination accidentelle des éléments nutritifs. Enfin, environ 1 000 cellules/puits ont été inoculées dans une plaque 96 puits à fond plat dans un volume final de 150 L d'un standard de métabolite ou d'un surnageant de chemostat, complété par SD + 164 M de lysine. Pour chaque souche auxotrophe, SD + 164 M de lysine additionnée de diverses concentrations connues de glutathion ont été utilisées pour établir une courbe standard qui reliait la concentration en organosulfures (en termes d'équivalent fmole de GSH) à la turbidité finale (S5 Fig). La turbidité obtenue dans un surnageant a ensuite été utilisée pour déduire la concentration en organosulfure dans le surnageant. Les plaques ont été enveloppées de parafilm pour empêcher l'évaporation et incubées à 30 °C pendant 2 à 3 jours. Nous avons remis les cellules en suspension à l'aide d'un Thermo Fisher Scientific Teleshake (réglage #5 pendant environ 1 min) et lu la turbidité de la culture à l'aide d'un lecteur de plaques BioTek Synergy MX (Winooski, VT, USA).

Dans un essai biologique basé sur le taux (S4B Fig), la souche de levure mCherry-tagged auxotrophe pour organosulfur (WY2035) a été pré-cultivée dans SD + 164 M de lysine + 134 M de méthionine, et le taux de croissance a été suivi par densité optique pour s'assurer que la cellule se développait comme attendu. Ensuite, les cellules ont été lavées 3 fois dans SD + 164 M de lysine (manque de suppléments organosulfurés) et affamées pendant au moins 3 heures dans des tubes à essai de 13 mm nettoyés en usine. La DO a été mesurée à nouveau et les cellules ont été inoculées à environ 1 000 cellules/puits dans une plaque à 96 puits dans un volume total de 300 L. Le puits a été rempli soit de quantités connues d'organosulfure (méthionine ou glutathion) soit de surnageants récoltés, tous deux supplémentés en SD + 164 µM de lysine. La plaque à 96 puits a été mesurée de la même manière que précédemment décrite dans la section « Microscopie à fluorescence ».

Le taux de croissance maximal a été calculé en mesurant la pente de dans(Intensité normalisée) contre le temps. Pour chaque fenêtre glissante de 4 points dans le temps, la pente est calculée, et si elle dépasse la pente max actuelle pour le puits, elle est choisie comme nouveau maximum. Pour garantir qu'aucune estimation ne se produise lorsque d'autres métabolites tels que le glucose pourraient être limitants, nous avons limité l'analyse aux données à une intensité maximale de 25 % pour garantir que les cellules avaient au moins 2 doublements au-delà du moment où elles se développent théoriquement au maximum. Pour les essais biologiques basés sur les taux, les taux de croissance maximaux ont été utilisés pour estimer la taille approximative de la niche.

Cytométrie en flux

Une description détaillée peut être trouvée ailleurs [30]. Les compositions des populations ont été mesurées par cytométrie de flux en utilisant un DxP10 (Cytek, Fremont, CA, USA). Des billes fluorescentes de concentration connue (telle que déterminée par hémocytomètre) ont été ajoutées pour déterminer les densités cellulaires. Une dilution finale au 1:20 000 de ToPro3 (Molecular Probes T-3605 Eugene, OR, USA) a été utilisée pour chaque échantillon afin de déterminer les densités de cellules vivantes et mortes. L'analyse à l'aide du logiciel FlowJo a montré un regroupement évident de cellules vivantes et mortes dans le canal ToPro3 RedFL1, les cellules mortes ayant un signal RedFL1 de >10 3 . Les densités de cellules mortes n'étaient généralement jamais supérieures à 10 % dans toutes les conditions testées.

Extraction des métabolites

L'extraction des métabolites pour la quantification des organosulfures intracellulaires a été adaptée de [78]. En bref, 20 ml de populations de chemostat ont été récoltés avec des pipettes jetables de 25 ml et rapidement filtrés sous vide sur des filtres en nylon Magna de 0,45 µm prédécoupés (GVS Life Sciences, Sanford, ME, USA). À l'aide d'une pince nettoyée à l'éthanol, le filtre a ensuite été rapidement immergé dans 3 ml de mélange d'extraction glacé : 40 % (v/v) d'acétonitrile, 40 % (v/v) de méthanol et 20 % (v/v) d'eau distillée— contenu dans un tube à centrifuger stérile de 5 ml. Tous les réactifs étaient de qualité HPLC et tous les mélanges d'extraction ont été préparés frais avant chaque extraction. Le tube de centrifugation a été bouché et rapidement vortexé pour déloger toutes les cellules, et la membrane filtrante a été jetée. L'ensemble du processus a pris moins de 25 secondes, le temps entre les populations filtrées et immergées dans le tampon d'extraction étant inférieur à 10 secondes. Une fois toutes les populations récoltées, les extraits ont été congelés à -80°C ou dans de l'azote liquide jusqu'à ce qu'ils soient solides, transférés dans de la glace et laissés décongeler. Une fois les échantillons décongelés, ils ont été incubés sur de la glace pendant 10 minutes et vortexés une fois toutes les 3 minutes environ et ramenés à -80°C pour une recongélation (un seul cycle de « congélation-décongélation »). Après 3 cycles de congélation-décongélation, 1,5 ml d'échantillon a été récolté et transféré dans un nouveau tube de microcentrifugation de 1,5 ml et centrifugé à 13 000 tr/min pendant 2 minutes à 4°C pour sédimenter les débris cellulaires. L'extrait a été retiré et le culot cellulaire restant a été extrait à nouveau avec 1,5 ml de mélange d'extraction et centrifugé. Le résultat final était de 3 ml de métabolites extraits qui ont été stockés à -80°C et analysés par HPLC moins de 48 heures après l'extraction. Pour les essais biologiques, cet extrait a été dilué 10 fois dans de l'eau stérile ou SD. Pour vérifier qu'une majorité de métabolites ont été extraits, 100 L de tampon d'extraction frais ont été ajoutés aux débris cellulaires collectés, vortexés vigoureusement et collectés par centrifugation. Ce « second extrait » de 100 L a également été analysé pour le glutathion par HPLC. En moyenne, la quantité de glutathion dans le second extrait était <2% de la quantité extraite initialement dans l'extraction de 3 ml.

Un protocole modifié a été utilisé pour ade − extraits cellulaires. Nous avons vérifié indépendamment que les 2 protocoles conduisaient à des résultats comparables dans le rencontré10 essai biologique basé sur le rendement (données S5). ade − les cultures chemostat ont été filtrées sur membranes de nitrocellulose de 0,45 µm (Bio-Rad, Hercules, CA, USA), remises en suspension dans le mélange d'extraction, et surgelées dans l'azote liquide. Les échantillons ont été décongelés à -20°C pendant 30 minutes, avec un vortex toutes les 5 minutes. Les débris cellulaires ont été sédimentés par centrifugation à 13 000 tr/min pendant 10 minutes à 4°C. Après que le surnageant ait été transféré dans un tube frais, le culot a été extrait avec la moitié du volume d'origine du mélange d'extraction, et les surnageants des 2 cycles d'extraction ont été combinés. Le mélange d'extraction a été séché en utilisant le réglage de basse température sur un speed-vac, et les composants déshydratés ont été remis en suspension dans de l'eau distillée stérile.

À partir de la quantité totale de métabolites dans l'échantillon et du nombre total de cellules utilisées pour extraire les métabolites, nous pouvons calculer la quantité moyenne de métabolite par cellule.

Quantification chimique analytique du GSH et des GSX

Le glutathion réduit a été dérivé à l'aide d'une sonde spécifique au thiol décrite pour la première fois par [79], appelée Thiol Probe IV (EMD Millipore, Burlington, MA, USA) pour fabriquer un conjugué de glutathion fluorescent. Le composé réagit facilement avec les thiols libres, bien qu'à des vitesses différentes. Pour quantifier le glutathion, 270 L d'échantillon ou de GSH standard en SD ont été ajoutés à 30 L de tampon HEPES 833 mM (pH 7,8). Cela a été fait pour élever le pH de l'échantillon à un niveau basique, ce qui facilite la réaction. Ensuite, la sonde (dissoute dans du DMSO et stockée dans des aliquotes de 50 μL à -20°C) a été ajoutée à une concentration finale de 100 M, ce qui dépasse d'au moins 10 fois le glutathion. La réaction a été réalisée à température ambiante dans l'obscurité (la sonde est photosensible) dans une plaque 96 puits pendant 20 minutes. Après cela, 8,4 L de HCl 2M ont été ajoutés pour éteindre rapidement la réaction en abaissant le pH à environ 2. Cela stabilise également le conjugué fluorescent. L'échantillon entier a ensuite été ajouté à un insert de classe de pointe tirée de petit volume de 250 μL (Réf Agilent : 5183-2085 Santa Clara, CA, États-Unis) pour faciliter l'accès à l'aiguille de l'échantillonneur automatique. L'insert de petit volume avec l'échantillon a ensuite été placé à l'intérieur d'un flacon d'échantillonneur automatique brun foncé de 1,5 ml (numéro de pièce Shimadzu : 228-45450-91 Kyoto, Japon) et fermé avec un nouveau bouchon à vis de 9 mm avec septum en PTFE (numéro de pièce Shimadzu : 228-45454-91).

Le glutathion dérivé a été séparé et identifié par chromatographie en phase inverse. 10 L du mélange réactionnel ont été injectés sur une colonne LC Synergi 4-μM Hydro-RP 80-Å, 150 × 4,6 mm (Phenomenex, Part No: 00F-4375-E0 Torrance, CA, USA), équipée d'une cartouche SecurityGuard AQ C18 4 x 3,00 mm ID (Phenomenex, référence : AJO-7511) dans un porte-cartouche SecurityGuard (Phenomenex, référence : KJ0-4282). Le SecurityGuard (précolonne) était remplacé périodiquement chaque fois que la lecture de la pression dépassait les spécifications du fabricant. Le glutathion a été élué de la colonne avec un gradient de phase mobile d'eau Millipore filtrée (Solution A) et d'acétonitrile (Solution B, qualité HPLC). L'eau Millipore a été filtrée à travers un filtre de 0,22 µM avant utilisation. De plus, avant chaque analyse, la colonne a été équilibrée pendant 30 minutes avec la solution B à 1%. Le pourcentage de solution B a suivi le programme suivant pour chaque injection : 0 min 1%, 10 min 14%, 10,01 min 1% et 15 min 1%, correspondant à une augmentation progressive jusqu'à 14% de Solution B sur 10 minutes, suivi d'un rééquilibrage avec 1% de Solution B. La colonne a été maintenue à une température de fonctionnement de 25°C dans un four Nexera X2 CTO-20A ( Shimadzu). Le débit était de 1 ml/min. Dans ces conditions, le glutathion a été élué à environ 7 minutes, avec une légère variation d'une série à l'autre. Le glutathion fluorescent a été détecté par excitation à 400 nm et émission à 465 nm. Après chaque cycle, la colonne a été lavée et stockée conformément aux instructions du fabricant.

L'analyse des données HPLC a été effectuée à l'aide du langage statistique R avec un logiciel personnalisé pour la sélection des pics, la correction de la ligne de base, le tracé et l'estimation de la zone, qui est disponible gratuitement sur

Les surnageants ont été expédiés pendant la nuit sur de la glace sèche au laboratoire Rabinowitz de l'Université de Princeton. Le composé isotopique stable [2-13 C, 15 N] GSH a été obtenu auprès de Cambridge Isotope Laboratories. L'eau de qualité HPLC, le méthanol et l'acétonitrile ont été obtenus auprès de Thermo Fisher Scientific. L'échantillon de surnageant a été décongelé à température ambiante et 30 L de surnageant avec 5 L de 10 M de GSH marqué 2-13 C + 15 N ont été transférés dans un tube à centrifuger de 1,5 ml. Les échantillons ont été soit analysés directement pour mesurer le GSH uniquement, soit d'abord traités avec de la tris(2-carboxyéthyl)phosphine (TCEP) pour réduire le GSX en GSH avant de mesurer le GSH total. Pour les échantillons avec traitement TCEP, 5 L de 60 g/L de solution TCEP (réactif réducteur) ont été ajoutés dans l'échantillon. Le mélange résultant a été vortexé et incubé pendant 20 minutes à température ambiante. Ensuite, 10 L de 15% NH4HCO3 (p/v) a été introduit pour neutraliser le pH du solvant. La solution a été séchée sous N2 débit, remis en suspension dans 50 L de solvant 40:40:20 (méthanol/acétonitrile/eau) et maintenu à 4°C dans un passeur d'échantillons.

Les échantillons ont été analysés à l'aide d'un spectromètre de masse Q Exactive Plus couplé au système Vanquish UHPLC (Thermo Fisher Scientific). La séparation LC a été réalisée à l'aide d'une colonne XBridge BEH Amide (2,1 mm × 150 mm, taille des particules de 2,5 m, taille des pores de 130 Waters, Milford, MA, USA) en utilisant un gradient de solvant A (20 mM d'acétate d'ammonium + 20 mM hydroxyde d'ammonium dans 95:5 eau/acétonitrile [pH 9,45]) et solvant B (acétonitrile). Le débit était de 150 µl/min. Le gradient était de 0 min, 90 % B 2 min, 90 % B 5 min, 50 % B 10 min, 0 % B 13,5 min, 0 % B 15 min, 90 % B 20 min, 90 % B. La température de la colonne était 25°C, et le volume d'injection était de 10 L. Les paramètres du spectromètre de masse sont le mode ion positif, résolution 140 000 à m/z 200, plage de balayage m/z 290-650, cible AGC 3E6, temps d'injection maximum 200 ms. La quantification des concentrations de GSH dans les échantillons a été réalisée en comparant les zones de pic de glutathion à celles de 13 C-GSH. Les données ont été analysées à l'aide du logiciel MAVEN [80].

Concurrence

Pour quantifier plusieurs réplicats de compétition à plusieurs ratios de souche initiaux, nous avons utilisé le système de coculture pour imiter l'environnement limité en lysine, en particulier parce que des mutations similaires dans les chemostats limités en lysine en coculture et en monoculture signifiaient que les environnements étaient similaires. Pour ce faire, WY1340 (la souche nécessitant de la purine/libérant de la lysine dans le fond RM11) a été cultivé jusqu'à la phase exponentielle pendant la nuit dans SD + 134 M d'adénine, lavé 3 fois avec SD pour éliminer l'adénine et affamé pendant 24 heures pour épuiser vacuolaire espace de rangement. Pendant cette famine, WY2072/2073 (BFP rencontré10-clones évolués) et WY2429 (mCherry MET10-clone évolué) ont été cultivés pendant une nuit dans SD + 134 M de méthionine jusqu'en phase exponentielle et lavés 3 fois avec SD pour éliminer l'excès de méthionine et de lysine. WY2072/3 et WY2429 surproduisent et libèrent de l'hypoxanthine qui peut favoriser la croissance de la souche partenaire WY1340. Ensuite, WY2072/3 et WY2429 ont été mélangés dans des ratios de 1:100, 1:10, 1:1 et 10:1 à une OD finale600 de 0,1. Ce mélange de populations a ensuite été ajouté 1:1 avec WY1340 à une DO finale600 de 0,03. Cela a été considéré comme la génération 0. Les populations ont été surveillées pour la croissance en mesurant la densité optique au fil du temps et diluées périodiquement à OD600 0,03 (DO600 n'a jamais été supérieure à 0,45 pour s'assurer qu'aucun métabolite supplémentaire de SD n'était limitatif). L'OD600 les données ont été utilisées pour rétrocalculer les générations totales dans l'expérience. Périodiquement, 100 ul de la culture ont été échantillonnés pour la cytométrie en flux afin de suivre les ratios de souche. Des expériences ont été effectuées jusqu'à ce que le rapport de déformation se stabilise.

Test d'autophagie

Les activités d'autophagie ont été mesurées à l'aide du test de clivage GFP-Atg8 [28]. Souches de levure avec ura3 suppression dans lys − et lysrencontré17 − le bruit de fond a été généré via des croisements et transformé avec le plasmide GFP-Atg8 (Addgene 49425 Watertown, MA, USA) pour générer les 2 souches utilisées dans les tests d'autophagie - WY2520 (lys − ) et WY2521 (lysorgS − ). Ce plasmide exprime ATG8 avec un tag GFP N-terminal sous le promoteur endogène dans un vecteur pRS416 avec un URA3 marqueur de sélection [81]. Pour chaque expérience, WY2520 et WY2521 ont été striés sur des plaques SC-Ura [74] à partir de stocks congelés et des nuits saturées ont été cultivées à partir de colonies uniques dans un milieu SC-Ura. Des cultures d'un volume de 25 à 50 ml ont été inoculées pendant la nuit dans SD + 164 M de lysine (WY2520) ou SD + 164 M de lysine + 134 M de GSH (WY2521) dans des fioles coniques et cultivées pendant 18 à 20 heures à 30 °C jusqu'à un densité cellulaire souhaitée. Conformément aux protocoles publiés, les essais initiaux visaient une DO de départ de 0,7 à 1,0 pour la famine. Cependant, nous avons observé que des densités cellulaires élevées pourraient entraîner un clivage GFP-Atg8 plus élevé, même dans les cellules non affamées. Ainsi, dans les essais ultérieurs, la famine a été initiée à une DO comprise entre 0,2 et 0,6. Les cellules ont été sédimentées dans des tubes Falcon de 50 ml et lavées trois fois dans de l'eau milliQ stérile. Après les lavages, les cellules ont été remises en suspension dans le milieu de famine de choix (voir les détails ci-dessous) dans des tubes nettoyés en usine à une DO de 0,1 à 0,2. Pour les conditions dans lesquelles les cellules n'ont pas arrêté la croissance lors de la famine (principalement la famine d'organosulfure), les cultures ont été périodiquement diluées pour minimiser l'influence des limitations de nutriments secondaires causées par des densités cellulaires élevées. Pour l'analyse temporelle, la famine a été réalisée dans des cultures de 10 ml dans des tubes de 18 mm, et 2 ml de la culture ont été prélevés pour analyse à 24, 48 et 72 heures après le début de la famine. Pour les dosages avec un seul échantillonnage à point temporel, la famine a été réalisée dans des cultures de 3 ml dans des tubes de 13 mm. lys − les cellules ont été affamées pendant 4 ou 8 heures, avec des résultats comparables observés pour les deux traitements. lysorgS − les cellules ont été affamées pendant 72 heures après que l'analyse temporelle a révélé que l'influence de la privation d'organosulfure n'était discernable qu'après 48 heures dans le test de clivage GFP-Atg8.

Les milieux de famine pour différents traitements sont décrits ici. Pour lys − cellules, le manque de lysine a été réalisé en milieu SD les manques d'azote ont été réalisés en milieu SD-N soit additionné de 164 µM de lysine (seulement manque d'azote) soit dépourvu (double manque de lysine et d'azote). Pour lysorgS − cellules, une double privation de lysine et d'organosulfure a été réalisée en milieu SD, une privation de lysine a été réalisée en SD + 134 µM GSH, et une privation d'organosulfure a été réalisée en SD + 164 µM de lysine.

La préparation des échantillons a été effectuée comme suggéré dans [82] avec des modifications mineures. Les cellules de 2 à 4 ml de culture ont été agglomérées dans un tube de microcentrifugation à 5 000 × g pendant 3 minutes. Les culots cellulaires ont été congelés rapidement dans de l'azote liquide et stockés à -20°C jusqu'à ce que tous les échantillons aient été collectés pour une expérience. Pour la lyse cellulaire, les culots ont été remis en suspension dans 1 ml d'acide trichloracétique à 10 % glacé et laissés au repos dans un bloc métallique froid sur de la glace pendant 30 à 40 minutes. Les protéines ont été agglomérées à 16 000 × g pendant 1 minute à 4°C. Les pastilles ont été remises en suspension dans 1 ml d'acétone froide par vortex et sonication au bain et pastillées à nouveau par centrifugation. Le lavage à l'acétone a été répété une fois et les pastilles ont été laissées à sécher à l'air pendant 5 minutes avant d'être remises en suspension dans un tampon d'échantillon SDS-PAGE (0,1 M Tris-HCl [pH 7,5], 2 % p/v de SDS, 10 % v/v de glycérol, 20 mM DTT). Sur la base de la DO mesurée au moment du prélèvement de l'échantillon, le volume du tampon de l'échantillon a été ajusté pour atteindre des cellules/μL comparables dans chaque échantillon. Des billes de verre lavées à l'acide (425 à 600 m Sigma G8771 Sigma-Aldrich, St. Louis, MO, USA) ont été ajoutées à chaque tube, ce qui équivaut à peu près à la moitié du volume de l'échantillon, et le culot a été remis en suspension en battant les billes pendant 35 secondes. Après centrifugation pendant 20 minutes pour permettre à la mousse de se déposer, les échantillons ont été chauffés dans un bloc métallique à 95°C pendant 10 minutes. Après une centrifugation de 3 minutes à 5 000 × g, les échantillons ont été passés sur un gel d'acrylamide à 12,5 % pendant 50 minutes à un courant constant de 30 mA. Les bandes ont été transférées sur une membrane PVDF 0,2 µm (Bio-Rad Trans-blot 162-0184) en utilisant un protocole de transfert humide à une tension constante de 60 V pendant 2 heures en chambre froide. Pour l'immunotransfert, la membrane a été incubée une nuit à 4°C avec un primaire monoclonal anti-GFP (JL-8 Clontech 632381 Clontech, Takara Bio, Mountain View, CA, USA) à une dilution de 1:5 000, suivi d'une pièce de 45 minutes incubation à température avec un secondaire anti-souris conjugué à la peroxydase de raifort (GE Healthcare Lifesciences [maintenant connu sous le nom de Cytiva] Marlborough, MA, États-Unis) à une dilution de 1:10 000. Les anticorps ont été détectés en utilisant le substrat chimioluminescent SuperSignal West Dura (Thermo Fisher Scientific). Le plugin Gel Analyzer préinstallé sur ImageJ a été utilisé pour la quantification des bandes.


Fonctions du système urinaire


Le système urinaire produit l'urine et la conduit à l'extérieur du corps.Lorsque les reins produisent de l'urine, ils remplissent quatre fonctions : l'excrétion des déchets métaboliques, le maintien de l'équilibre eau-sel, le maintien de l'équilibre acido-basique et la sécrétion d'hormones.

Excrétion des déchets métaboliques
Les reins sécrètent des déchets métaboliques, notamment des déchets azotés. L'urée est le principal produit final azoté du métabolisme chez les êtres humains, mais les humains excrètent également de l'ammonium, de la créatinine et de l'acide urique. Urée est un sous-produit du métabolisme des acides aminés. La dégradation des acides aminés dans le foie libère de l'ammoniac, que le foie combine avec du dioxyde de carbone pour produire de l'urée. L'ammoniac est très toxique pour les cellules, mais l'urée est beaucoup moins toxique. Parce qu'il est moins toxique, moins d'eau est nécessaire pour excréter l'urée. La créatine phosphate est une molécule de réserve de phosphate à haute énergie dans les muscles. La dégradation métabolique de la créatine phosphate entraîne créatinine. La dégradation des nucléotides, tels que ceux contenant de l'adénine et de la thymine, produit acide urique. L'acide urique est plutôt insoluble. Si trop d'acide urique est présent dans le sang, des cristaux se forment et précipitent. Des cristaux d'acide urique s'accumulent parfois dans les articulations, produisant une maladie douloureuse appelée goutte.

Maintien de l'équilibre eau-sel
Une fonction principale des reins est de maintenir l'équilibre eau-sel approprié du sang. Comme nous le verrons, le volume sanguin est intimement associé à l'équilibre salin de l'organisme. Comme vous le savez, les sels, comme le NaCl, ont la capacité de provoquer l'osmose, la diffusion de l'eau - dans ce cas, dans le sang. Plus il y a de sels dans le sang, plus le volume sanguin est élevé et plus la pression artérielle est élevée. De cette façon, les reins sont impliqués dans la régulation de la pression artérielle. Les reins maintiennent également le niveau approprié d'autres ions (électrolytes), tels que les ions potassium (K + ), les ions bicarbonate (HCO 3 - ) et les ions calcium (Ca 2 + ), dans le sang.

Reins
Les reins sont des organes appariés situés près du bas du dos dans la région lombaire de chaque côté de la colonne vertébrale. Ils se trouvent dans des dépressions contre les muscles profonds du dos sous le péritoine, où ils reçoivent une certaine protection de la cage thoracique inférieure. Chaque rein est généralement maintenu en place par du tissu conjonctif, appelé fascia rénal. Des masses de tissu adipeux adhèrent à chaque rein. Un coup sec dans le dos peut déloger un rein, qui s'appelle alors un rein flottant. Les reins sont en forme de haricot et de couleur brun rougeâtre. Les organes de la taille d'un poing sont recouverts d'une capsule dure de tissu conjonctif fibreux, appelée capsule rénale. Le côté concave d'un rein a une dépression appelée le hile où un artère rénale entre et un veine rénale et un uretère sort du rein.

Uretères
Les uretères, qui s'étendent des reins à la vessie, sont de petits tubes musculaires d'environ 25 cm de long et 5 mm de diamètre. Chacun descend derrière le péritoine pariétal, du hile d'un rein, pour pénétrer postérieurement dans la vessie à sa surface inférieure. La paroi d'un uretère a trois couches. La couche interne est une muqueuse (membrane muqueuse), la couche intermédiaire est constituée de muscle lisse et la couche externe est une couche fibreuse de tissu conjonctif. Les contractions péristaltiques font pénétrer l'urine dans la vessie même si une personne est allongée. L'urine pénètre dans la vessie par jets qui se produisent à raison de un à cinq par minute.

Vessie urinaire
Les vessie est situé dans la cavité pelvienne, sous le péritoine pariétal et juste en arrière de la symphyse pubienne. Chez les mâles, il est directement antérieur au rectum chez les femelles, il est antérieur au vagin et inférieur à l'utérus. Sa fonction est de stocker l'urine jusqu'à ce qu'elle soit expulsée du corps. La vessie a trois ouvertures, deux pour les uretères et une pour l'urètre, qui draine la vessie. Les trigone est une zone triangulaire lisse à la base de la vessie délimitée par ces trois ouvertures (Fig. 16.2) . Collectivement, les couches musculaires de la paroi de la vessie sont appelées les muscle détrusor. La paroi contient une couche intermédiaire de fibres circulaires et deux couches de muscles longitudinaux, et elle peut se dilater. L'épithélium transitionnel de la muqueuse s'amincit et se replie dans la muqueuse appelée rugae disparaissent au fur et à mesure que la vessie s'agrandit. La vessie a d'autres caractéristiques qui lui permettent de retenir l'urine. Une fois que l'urine pénètre dans la vessie à partir d'un uretère, de petits plis de la muqueuse de la vessie agissent comme une valve pour empêcher le reflux. Deux sphincters à proximité se trouvent là où l'urètre sort de la vessie. Le sphincter interne se situe autour de l'ouverture de l'urètre. Inférieur au sphincter interne, le sphincter externe est composé de muscle squelettique qui peut être contrôlé volontairement.

Urètre
Les urètre est un petit tube qui s'étend de la vessie à une ouverture externe. L'urètre est d'une longueur différente chez les femmes que chez les hommes. Chez la femme, l'urètre n'a qu'environ 4 cm de long. La courte longueur de l'urètre féminin facilite l'invasion bactérienne et aide à expliquer pourquoi les femmes sont plus sujettes aux infections des voies urinaires que les hommes. Chez l'homme, l'urètre mesure en moyenne 20 cm lorsque le pénis est flasque (boiteux, non érigé). Lorsque l'urètre quitte la vessie masculine, il est encerclé par la prostate. Chez les hommes plus âgés, l'hypertrophie de la prostate peut restreindre la miction. Une intervention chirurgicale peut généralement corriger l'état et rétablir un flux d'urine normal. Chez les femelles, les systèmes reproducteur et urinaire ne sont pas connectés. Chez les hommes, l'urètre transporte l'urine pendant la miction et le sperme pendant l'éjaculation. Cette double fonction de l'urètre chez l'homme ne modifie pas le trajet de l'urine.

Miction
Lorsque la vessie se remplit à environ 250 ml d'urine, les récepteurs d'étirement envoient des impulsions nerveuses sensorielles à la moelle épinière. Par la suite, les impulsions nerveuses motrices de la moelle épinière provoquent la contraction de la vessie et le relâchement des sphincters, de sorte que la miction, également appelée miction, est possible (Fig. 16.2) . Chez les enfants plus âgés et les adultes, le cerveau contrôle ce réflexe, retardant la miction jusqu'à un moment approprié.

Maintien de l'équilibre acido-basique
Les reins régulent l'équilibre acido-basique du sang. Pour qu'une personne reste en bonne santé, le pH sanguin doit être d'environ 7,4. Les reins surveillent et contrôlent le pH sanguin, principalement en excrétant des ions hydrogène (H + ) et en réabsorbant les ions bicarbonate (HCO 3 - ) au besoin pour maintenir le pH sanguin à environ 7,4. L'urine a généralement un pH de 6 ou moins parce que notre alimentation contient souvent des aliments acides.

Sécrétion d'hormones
Les reins assistent le système endocrinien dans la sécrétion d'hormones. Les reins libèrent de la rénine, une substance qui conduit à la sécrétion de l'hormone aldostérone par le cortex surrénalien, la partie externe des glandes surrénales, qui se trouvent au sommet des reins. L'aldostérone favorise la réabsorption des ions sodium (Na + ) par les reins. Chaque fois que la capacité de transport d'oxygène du sang est réduite, les reins sécrètent l'hormone érythropoïétine, qui stimule la production de globules rouges. Les reins aident également à activer la vitamine D de la peau. La vitamine D est le précurseur de l'hormone calcitriol, qui favorise l'absorption du calcium (Ca 2 + ) par le tube digestif.

Organes du système urinaire
Le système urinaire comprend les reins, les uretères, la vessie et l'urètre. Graphique 16.1 montre ces organes et trace également le chemin de l'urine.


Questions structurées Solutions travaillées

1. Décrire 3 façons dont le tabagisme endommage les poumons

  • Le goudron déposé dans les poumons contient des substances cancérigènes et augmente le risque de cancer du poumon
  • Le monoxyde de carbone dans la fumée augmente le dépôt de graisse, si au niveau des artères coronaires, la lumière des artères se rétrécit et diminue l'apport sanguin, entraînant une crise cardiaque
  • Les irritants provoquent la toux. Une toux violente prolongée pourrait entraîner un emphysème dans lequel les parois alvéolaires se brisent

Volume de gaz produit dans la seringue (cm 3 )

(b) A partir des résultats du tableau 1, suggérer quel sucre serait un meilleur substrat respiratoire pour la levure.

(c) Suggérez pourquoi il y a une différence dans le taux de respiration lorsque la levure reçoit des sucres différents dans l'expérience.

(d) Mettez en surbrillance toute donnée anormale dans les résultats.

(e) Nommez une erreur possible dans cette expérience et proposez une amélioration ou une solution.

(b) Glycémie. Il donne un volume de dioxyde de carbone plus élevé que le saccharose au cours de la même période, ce qui indique qu'il peut être utilisé plus rapidement.

(c) La matière première utilisée pour la respiration est le glucose. Le saccharose est un disaccharide et doit d'abord être décomposé en glucose avant de pouvoir être utilisé dans la respiration. Par conséquent, le taux de respiration utilisant le saccharose est inférieur à celui du glucose.

(d) La lecture à 5 min pour la réplique 1 de glucose. Il est beaucoup plus élevé que la lecture de la réplique 2.

(e) Une partie du dioxyde de carbone libéré peut ne pas être enregistrée car l'air peut être comprimé à la place, utilisez un enregistreur de données. Le dioxyde de carbone est légèrement soluble dans l'eau et peut se dissoudre dans le mélange, utilisez plutôt un indicateur d'hydrogénocarbonate.

3. La figure 2 montre l'effet de l'acide lactique sur la quantité d'oxygène libérée par les globules rouges vers les cellules musculaires qui respirent activement.

(a) Expliquez pourquoi l'acide lactique se forme pendant une activité musculaire vigoureuse.

(b) En référence à la fig. 2, expliquent comment une concentration accrue d'acide lactique affecte la libération d'oxygène vers les cellules musculaires.

(c) Comment l'acide lactique est-il éliminé par le corps ?

(a) Au cours d'une activité musculaire vigoureuse, la respiration aérobie ne suffit pas à elle seule pour répondre à l'augmentation de la demande d'énergie. La respiration anaérobie a lieu dans les cellules musculaires pour compléter l'énergie de la respiration aérobie. La respiration anaérobie dans les cellules musculaires produit de l'acide lactique.

(b) Lorsqu'il y a une augmentation de la concentration d'acide lactique, le pourcentage d'oxyhémoglobine dans le sang diminue. Cela indique que plus d'oxygène est libéré de l'hémoglobine vers les cellules musculaires.

(c) L'acide lactique est éliminé par le corps soit par oxydation pour produire de l'énergie, soit par conversion en glucose dans le foie.

4a. Quels sont les symptômes de l'emphysème ?

4b. Nommez une cause d'emphysème

4a. difficulté respiratoire, respiration sifflante, essoufflement

5. Expliquez l'importance de chacun des éléments suivants par rapport à leur fonction dans la respiration


Voir la vidéo: Formation of Urine - Nephron Function, Animation. (Février 2023).